Incidental Mutation 'R4658:Olfr121'
ID352640
Institutional Source Beutler Lab
Gene Symbol Olfr121
Ensembl Gene ENSMUSG00000060017
Gene Nameolfactory receptor 121
SynonymsMOR263-4, GA_x6K02T2PSCP-2211113-2212078
MMRRC Submission 041918-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.018) question?
Stock #R4658 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location37748855-37753169 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 37752163 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 103 (C103F)
Ref Sequence ENSEMBL: ENSMUSP00000084377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074555] [ENSMUST00000174675]
Predicted Effect probably damaging
Transcript: ENSMUST00000074555
AA Change: C103F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000084377
Gene: ENSMUSG00000060017
AA Change: C103F

DomainStartEndE-ValueType
Pfam:7tm_4 37 314 2.9e-56 PFAM
Pfam:7TM_GPCR_Srsx 41 311 2.1e-5 PFAM
Pfam:7tm_1 47 296 8.3e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000174675
AA Change: C103F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000133865
Gene: ENSMUSG00000060017
AA Change: C103F

DomainStartEndE-ValueType
transmembrane domain 33 55 N/A INTRINSIC
Meta Mutation Damage Score 0.566 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 99% (88/89)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb A T 5: 114,200,564 R778S probably damaging Het
Adam17 A G 12: 21,332,160 C567R probably damaging Het
Ankrd28 G A 14: 31,710,868 A758V probably damaging Het
Atrn T C 2: 130,933,429 Y151H probably damaging Het
B3gat3 A G 19: 8,925,632 T118A possibly damaging Het
Camta1 A G 4: 151,143,910 C822R probably damaging Het
Capn15 G T 17: 25,960,768 Q807K probably benign Het
Clec12a T C 6: 129,354,530 Y145H probably damaging Het
Clk1 T C 1: 58,412,987 I393V probably benign Het
Cpm A G 10: 117,668,051 I121V probably benign Het
Cux1 A G 5: 136,250,594 I405T possibly damaging Het
Dnah3 A G 7: 119,950,651 S3471P probably damaging Het
Dok6 A G 18: 89,473,847 probably benign Het
Eif4g1 A T 16: 20,685,934 D1124V possibly damaging Het
Eif4g3 A G 4: 138,206,132 E1756G probably damaging Het
Exo5 A G 4: 120,922,551 V39A probably benign Het
Fmnl1 A T 11: 103,197,694 I90F probably damaging Het
Fryl G T 5: 73,081,053 T1450K probably damaging Het
Gde1 T C 7: 118,694,528 M91V probably benign Het
Gimd1 T C 3: 132,644,582 I84T probably damaging Het
Gm13889 C T 2: 93,957,108 probably benign Het
Gm6445 T A 19: 9,608,197 noncoding transcript Het
Gm8113 T C 14: 43,932,410 S483P probably damaging Het
Grik2 T C 10: 49,523,792 I281V possibly damaging Het
Grik5 T C 7: 25,060,727 probably benign Het
Herc1 A T 9: 66,479,491 I3796F possibly damaging Het
Hoxb13 A T 11: 96,194,483 D14V probably benign Het
Hspg2 A G 4: 137,533,730 Y1645C probably damaging Het
Igkv8-16 G T 6: 70,386,778 R87S probably damaging Het
Ints1 A T 5: 139,774,299 V140E possibly damaging Het
Kbtbd11 C A 8: 15,028,917 D505E possibly damaging Het
Kcnu1 G A 8: 25,937,555 C300Y probably damaging Het
Kmt2d G C 15: 98,852,529 probably benign Het
Lats1 T C 10: 7,702,729 V539A probably benign Het
Lipo5 C T 19: 33,464,522 G200D unknown Het
Lmo7 C A 14: 101,886,957 A284D probably damaging Het
Lyst G A 13: 13,635,383 R546H probably damaging Het
Mcpt8 T C 14: 56,083,828 M60V possibly damaging Het
Mdn1 A G 4: 32,730,749 probably null Het
Mphosph10 A G 7: 64,388,974 probably null Het
Muc5b G A 7: 141,841,398 S47N unknown Het
Notch3 A T 17: 32,154,763 N490K probably damaging Het
Nr1d1 G A 11: 98,771,912 S85L possibly damaging Het
Obscn T A 11: 59,054,288 R4635* probably null Het
Olfr1504 T C 19: 13,887,548 I221V probably benign Het
Olfr275 T C 4: 52,826,240 L281P probably damaging Het
Pappa G A 4: 65,314,796 probably null Het
Pcdhb17 G A 18: 37,486,599 G481S probably damaging Het
Pde1a TCC TC 2: 79,898,181 probably benign Het
Phf3 A T 1: 30,863,088 M48K probably damaging Het
Pira2 A T 7: 3,840,934 V613E probably damaging Het
Poc1a T C 9: 106,349,688 S327P possibly damaging Het
Ptpn9 A G 9: 57,020,037 H66R probably benign Het
Rabgap1 C T 2: 37,487,549 R353* probably null Het
Rcc1l G T 5: 134,171,890 N134K probably damaging Het
Rims1 G A 1: 22,427,543 T787I probably damaging Het
Rreb1 T G 13: 37,948,801 S1651A probably damaging Het
Rsl1d1 T C 16: 11,201,374 D100G probably damaging Het
Samd4 C T 14: 47,064,246 R147C probably damaging Het
Serpinb6e T C 13: 33,841,316 probably benign Het
Ska1 T C 18: 74,197,040 I210V probably benign Het
Slc17a1 A G 13: 23,878,560 I237V probably benign Het
Slc22a4 A T 11: 53,997,510 S231T probably benign Het
Slc7a4 T A 16: 17,575,933 M66L probably damaging Het
Snapc1 A G 12: 73,983,868 T381A possibly damaging Het
St6galnac2 C T 11: 116,684,525 probably benign Het
Taar2 C T 10: 23,941,503 L314F probably benign Het
Tmem74b A G 2: 151,706,641 D96G probably damaging Het
Tnfrsf17 T C 16: 11,313,969 F6S probably benign Het
Tpp2 G T 1: 43,954,710 G252W probably damaging Het
Trf A G 9: 103,223,608 F209L probably damaging Het
Ttn T C 2: 76,898,591 probably benign Het
Uhmk1 A T 1: 170,207,205 H311Q probably damaging Het
Unc13c G T 9: 73,932,826 Q248K probably damaging Het
Uqcrc2 A G 7: 120,650,921 Y253C probably damaging Het
Vmn2r117 A G 17: 23,478,416 F101L probably benign Het
Vmn2r43 T C 7: 8,255,071 N381S probably benign Het
Zfp879 T A 11: 50,833,197 Y271F probably damaging Het
Other mutations in Olfr121
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01348:Olfr121 APN 17 37752286 missense probably benign 0.03
R0100:Olfr121 UTSW 17 37752703 missense probably benign 0.12
R0328:Olfr121 UTSW 17 37752393 missense possibly damaging 0.57
R1641:Olfr121 UTSW 17 37752025 missense possibly damaging 0.90
R2358:Olfr121 UTSW 17 37752380 nonsense probably null
R3711:Olfr121 UTSW 17 37752380 nonsense probably null
R3712:Olfr121 UTSW 17 37752380 nonsense probably null
R4913:Olfr121 UTSW 17 37752424 missense possibly damaging 0.86
R5229:Olfr121 UTSW 17 37752301 missense probably benign 0.00
R5611:Olfr121 UTSW 17 37752084 missense possibly damaging 0.94
R6159:Olfr121 UTSW 17 37752147 missense probably damaging 1.00
R6375:Olfr121 UTSW 17 37752099 missense probably benign
R6500:Olfr121 UTSW 17 37752686 missense probably damaging 1.00
R6818:Olfr121 UTSW 17 37752424 missense possibly damaging 0.86
R7027:Olfr121 UTSW 17 37752409 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGACAGGAAATGAACTCATAGC -3'
(R):5'- GGGTCCACAGAAGTTCAACG -3'

Sequencing Primer
(F):5'- ATGAACTCATAGCCATTGCCATCTG -3'
(R):5'- AAAATTGGTTTGTCCCAACCC -3'
Posted On2015-10-08