Incidental Mutation 'R0270:Nfkb2'
ID35275
Institutional Source Beutler Lab
Gene Symbol Nfkb2
Ensembl Gene ENSMUSG00000025225
Gene Namenuclear factor of kappa light polypeptide gene enhancer in B cells 2, p49/p100
SynonymsNF kappaB2, p52
MMRRC Submission 038496-MU
Accession Numbers

Genbank: NM_019408; MGI: 1099800

Is this an essential gene? Possibly non essential (E-score: 0.437) question?
Stock #R0270 (G1)
Quality Score151
Status Validated
Chromosome19
Chromosomal Location46304737-46312090 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 46311626 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 838 (M838L)
Ref Sequence ENSEMBL: ENSMUSP00000107512 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041391] [ENSMUST00000073116] [ENSMUST00000096029] [ENSMUST00000111881] [ENSMUST00000224556] [ENSMUST00000225323]
Predicted Effect probably benign
Transcript: ENSMUST00000041391
SMART Domains Protein: ENSMUSP00000039728
Gene: ENSMUSG00000037126

DomainStartEndE-ValueType
low complexity region 48 63 N/A INTRINSIC
low complexity region 79 99 N/A INTRINSIC
low complexity region 329 368 N/A INTRINSIC
low complexity region 419 431 N/A INTRINSIC
low complexity region 445 466 N/A INTRINSIC
Sec7 519 708 5.08e-75 SMART
low complexity region 714 724 N/A INTRINSIC
low complexity region 736 744 N/A INTRINSIC
PH 757 871 1.87e-13 SMART
Blast:Sec7 900 952 1e-6 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000073116
AA Change: M838L

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000072859
Gene: ENSMUSG00000025225
AA Change: M838L

DomainStartEndE-ValueType
Pfam:RHD_DNA_bind 40 220 1.3e-67 PFAM
IPT 227 326 3.48e-27 SMART
low complexity region 351 382 N/A INTRINSIC
low complexity region 391 409 N/A INTRINSIC
ANK 487 522 5.58e1 SMART
ANK 526 555 9.78e-4 SMART
ANK 559 591 3.74e0 SMART
ANK 599 628 3.36e-2 SMART
ANK 633 663 1.3e1 SMART
ANK 667 696 4.26e-4 SMART
low complexity region 707 721 N/A INTRINSIC
ANK 729 758 2.35e3 SMART
DEATH 764 851 5.52e-16 SMART
low complexity region 879 894 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000096029
SMART Domains Protein: ENSMUSP00000093729
Gene: ENSMUSG00000037126

DomainStartEndE-ValueType
low complexity region 48 63 N/A INTRINSIC
low complexity region 79 99 N/A INTRINSIC
low complexity region 329 368 N/A INTRINSIC
low complexity region 419 431 N/A INTRINSIC
low complexity region 445 466 N/A INTRINSIC
Sec7 520 709 5.08e-75 SMART
low complexity region 715 725 N/A INTRINSIC
low complexity region 737 745 N/A INTRINSIC
PH 758 872 1.87e-13 SMART
Blast:Sec7 901 953 1e-6 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000111881
AA Change: M838L

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000107512
Gene: ENSMUSG00000025225
AA Change: M838L

DomainStartEndE-ValueType
Pfam:RHD 40 220 1.3e-67 PFAM
IPT 227 326 3.48e-27 SMART
low complexity region 351 382 N/A INTRINSIC
low complexity region 391 409 N/A INTRINSIC
ANK 487 522 5.58e1 SMART
ANK 526 555 9.78e-4 SMART
ANK 559 591 3.74e0 SMART
ANK 599 628 3.36e-2 SMART
ANK 633 663 1.3e1 SMART
ANK 667 696 4.26e-4 SMART
low complexity region 707 721 N/A INTRINSIC
ANK 729 758 2.35e3 SMART
DEATH 764 851 5.52e-16 SMART
low complexity region 879 894 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000224556
Predicted Effect probably benign
Transcript: ENSMUST00000225323
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225748
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226062
Meta Mutation Damage Score 0.04 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.7%
  • 10x: 96.0%
  • 20x: 93.2%
Validation Efficiency 99% (113/114)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the transcription factor complex nuclear factor-kappa-B (NFkB). The NFkB complex is expressed in numerous cell types and functions as a central activator of genes involved in inflammation and immune function. The protein encoded by this gene can function as both a transcriptional activator or repressor depending on its dimerization partner. The p100 full-length protein is co-translationally processed into a p52 active form. Chromosomal rearrangements and translocations of this locus have been observed in B cell lymphomas, some of which may result in the formation of fusion proteins. There is a pseudogene for this gene on chromosome 18. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygotes for targeted null mutations exhibit gastric hyperplasia, enlarged lymph nodes, enhanced cytokine production by activated T cells, absence of Peyer's patches, increased susceptibility to Leishmania major, and early postnatal mortality. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, knock-out(5) Chemically induced(2)

Other mutations in this stock
Total: 109 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik T A 1: 120,166,176 probably benign Het
4922502D21Rik A T 6: 129,325,608 L152* probably null Het
Abcf3 T A 16: 20,560,168 probably null Het
Acadm C T 3: 153,936,324 M190I possibly damaging Het
Adamtsl3 G A 7: 82,556,824 R739Q probably damaging Het
Ank1 T A 8: 23,088,925 probably benign Het
Ap3b1 T A 13: 94,404,118 probably benign Het
Arhgdib A G 6: 136,926,734 V31A probably damaging Het
Arid4a A G 12: 71,072,632 R342G probably damaging Het
Asic3 C T 5: 24,417,702 L517F probably benign Het
Atxn7l1 C T 12: 33,342,151 P242L possibly damaging Het
AY761185 T A 8: 20,944,600 E37D possibly damaging Het
Babam1 T A 8: 71,398,406 D104E probably damaging Het
Batf A T 12: 85,708,672 T100S probably benign Het
Blcap A T 2: 157,557,977 Y59* probably null Het
Cacnb3 G A 15: 98,642,559 A350T probably damaging Het
Cdk15 T A 1: 59,310,806 V319D probably damaging Het
Cenpf T C 1: 189,650,714 H2661R probably benign Het
Cenpq T C 17: 40,930,050 E106G probably damaging Het
Cfap43 A G 19: 47,797,203 probably benign Het
Cfb G A 17: 34,860,386 S778L possibly damaging Het
Clspn T A 4: 126,573,236 N631K probably damaging Het
Cntn2 T A 1: 132,521,724 T660S probably damaging Het
Cntrob T A 11: 69,311,341 H475L possibly damaging Het
Ddx46 T C 13: 55,674,104 I863T probably benign Het
Dnah11 G A 12: 118,041,013 T2191I probably damaging Het
Dock9 T C 14: 121,575,999 T1703A probably benign Het
Fam13c C T 10: 70,544,513 P424S probably benign Het
Fan1 T C 7: 64,348,871 N968D probably benign Het
Fbxl20 A T 11: 98,098,503 probably benign Het
Fkbp1b A T 12: 4,838,229 probably benign Het
G930045G22Rik T A 6: 50,847,059 noncoding transcript Het
Gm28042 C A 2: 120,041,592 R1008S probably benign Het
Gm6614 T A 6: 141,972,411 I580F possibly damaging Het
Gm8298 T A 3: 59,877,019 N304K probably benign Het
Gon4l G A 3: 88,858,400 S376N probably damaging Het
Gstt3 C A 10: 75,780,915 R15L probably damaging Het
Gtdc1 A T 2: 44,752,174 S73T possibly damaging Het
H2afy G A 13: 56,096,114 probably benign Het
Hhatl A G 9: 121,784,720 S419P probably benign Het
Hirip3 T G 7: 126,863,191 S46R probably damaging Het
Hsf2 A G 10: 57,502,639 T204A probably benign Het
Impg2 G A 16: 56,269,015 E1108K possibly damaging Het
Itgb2l G T 16: 96,422,930 probably benign Het
Itih5 A T 2: 10,251,264 N847I probably benign Het
Kif1a T C 1: 93,054,442 probably benign Het
Klhl1 T A 14: 96,518,344 probably benign Het
Ktn1 T A 14: 47,714,662 D963E probably benign Het
Lclat1 T A 17: 73,240,027 V313E probably benign Het
Lrrn4 T C 2: 132,870,719 S395G probably benign Het
Mbtps1 G A 8: 119,538,117 probably benign Het
Me1 A G 9: 86,596,204 probably benign Het
Mov10 C A 3: 104,795,405 C948F probably benign Het
Mterf1a G A 5: 3,890,990 Q293* probably null Het
Nhlrc2 T A 19: 56,551,870 L97Q probably damaging Het
Nr6a1 A T 2: 38,739,020 Y331N possibly damaging Het
Nup214 C T 2: 32,034,814 A1785V probably damaging Het
Ogg1 C T 6: 113,329,256 T138I probably benign Het
Olfr1461 A G 19: 13,165,887 Y291C probably damaging Het
Olfr1489 A G 19: 13,633,684 Y191C probably damaging Het
Olfr202 A G 16: 59,283,753 V248A probably damaging Het
Olfr829 T A 9: 18,856,831 Y60N probably damaging Het
Plod2 G T 9: 92,584,521 R178L probably benign Het
Polr3b T A 10: 84,718,475 L1017Q probably benign Het
Postn C A 3: 54,384,550 T724N probably damaging Het
Ppm1l T G 3: 69,317,976 probably benign Het
Prpf8 T G 11: 75,505,249 L1983R probably damaging Het
Psma7 A G 2: 180,039,400 V59A probably benign Het
Qser1 T A 2: 104,788,961 Y502F probably benign Het
Rad50 T C 11: 53,668,025 D1129G probably damaging Het
Rasal1 C A 5: 120,674,729 P606Q probably damaging Het
Rgs6 A G 12: 83,133,689 Y438C probably damaging Het
Rnf180 A G 13: 105,252,266 C73R probably benign Het
Rnf216 T A 5: 143,080,241 I474F possibly damaging Het
Sdha A T 13: 74,332,247 L371Q probably damaging Het
Sdk1 T G 5: 142,084,566 L1162R possibly damaging Het
Sh3rf2 T C 18: 42,104,081 I223T probably damaging Het
Sirpb1a A G 3: 15,410,527 V316A probably damaging Het
Slc12a4 A T 8: 105,945,389 I897N probably benign Het
Slc35d1 A T 4: 103,190,838 V243E probably damaging Het
Slc4a11 T A 2: 130,690,932 K200N possibly damaging Het
Slc9a8 T A 2: 167,451,296 M188K probably damaging Het
Snrnp200 T C 2: 127,232,982 S1492P probably damaging Het
Sphk2 T C 7: 45,710,725 *618W probably null Het
Sytl2 T C 7: 90,403,020 probably benign Het
Tdpoz3 A G 3: 93,826,924 N302S probably benign Het
Tdrd6 T C 17: 43,624,308 M1950V probably benign Het
Tmem39a A G 16: 38,564,313 probably benign Het
Trip4 A T 9: 65,858,358 I353K probably damaging Het
Trip6 A T 5: 137,312,841 F204L probably benign Het
Trpm4 T A 7: 45,319,253 I419F possibly damaging Het
Ttn C A 2: 76,944,796 E1967D probably damaging Het
Uba2 C T 7: 34,150,856 V391M possibly damaging Het
Ubr4 T G 4: 139,479,435 probably benign Het
Upf1 G A 8: 70,335,645 probably benign Het
Vmn1r228 A C 17: 20,776,596 V220G possibly damaging Het
Vmn2r79 A G 7: 87,003,386 M429V probably benign Het
Vps36 C T 8: 22,210,456 T210I possibly damaging Het
Wdr17 C T 8: 54,693,096 A90T possibly damaging Het
Ybx1 C T 4: 119,281,591 G126D probably benign Het
Yipf5 C A 18: 40,206,407 probably benign Het
Zdhhc5 A C 2: 84,690,115 S573A probably benign Het
Zfp457 A T 13: 67,293,927 C99S probably damaging Het
Zfp52 T A 17: 21,561,302 C471S probably damaging Het
Zfp558 C T 9: 18,467,956 V71I probably damaging Het
Zfp651 A G 9: 121,767,575 T666A probably benign Het
Zfp655 A G 5: 145,244,457 Y375C probably damaging Het
Zfp882 A T 8: 71,914,615 T429S probably benign Het
Zmym2 T C 14: 56,949,684 probably null Het
Other mutations in Nfkb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
xander APN 19 splice acceptor site
IGL01466:Nfkb2 APN 19 46308016 missense probably damaging 0.96
IGL01791:Nfkb2 APN 19 46309839 unclassified probably benign
IGL01966:Nfkb2 APN 19 46309690 missense probably benign 0.04
IGL03296:Nfkb2 APN 19 46309928 missense probably damaging 1.00
humbert UTSW 19 46307441 missense possibly damaging 0.86
lolita UTSW 19 46307720 critical splice donor site probably null
Nabukov UTSW 19 46308439 missense probably damaging 0.99
pale_fire UTSW 19 46311626 missense possibly damaging 0.96
R0561:Nfkb2 UTSW 19 46309862 missense possibly damaging 0.93
R1944:Nfkb2 UTSW 19 46308052 missense probably damaging 1.00
R2217:Nfkb2 UTSW 19 46307724 splice site probably null
R2878:Nfkb2 UTSW 19 46307441 missense possibly damaging 0.86
R4493:Nfkb2 UTSW 19 46308439 missense probably damaging 0.99
R4494:Nfkb2 UTSW 19 46308439 missense probably damaging 0.99
R4495:Nfkb2 UTSW 19 46308439 missense probably damaging 0.99
R4731:Nfkb2 UTSW 19 46308964 missense possibly damaging 0.74
R4752:Nfkb2 UTSW 19 46307567 missense probably benign 0.02
R4753:Nfkb2 UTSW 19 46307567 missense probably benign 0.02
R4777:Nfkb2 UTSW 19 46307567 missense probably benign 0.02
R4780:Nfkb2 UTSW 19 46309922 missense probably damaging 1.00
R4820:Nfkb2 UTSW 19 46308054 missense probably damaging 0.99
R4837:Nfkb2 UTSW 19 46307567 missense probably benign 0.02
R4839:Nfkb2 UTSW 19 46307567 missense probably benign 0.02
R5514:Nfkb2 UTSW 19 46311408 missense probably damaging 1.00
R5519:Nfkb2 UTSW 19 46307567 missense probably benign 0.02
R5549:Nfkb2 UTSW 19 46307567 missense probably benign 0.02
R5615:Nfkb2 UTSW 19 46307567 missense probably benign 0.02
R5616:Nfkb2 UTSW 19 46307567 missense probably benign 0.02
R5709:Nfkb2 UTSW 19 46310521 missense probably damaging 1.00
R6053:Nfkb2 UTSW 19 46311812 missense probably damaging 1.00
R6794:Nfkb2 UTSW 19 46307720 critical splice donor site probably null
S24628:Nfkb2 UTSW 19 46307567 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GTTGAGAAGCCTGGTGGACACATAC -3'
(R):5'- ACATTGGGGTTGCTGTACCGTAAG -3'

Sequencing Primer
(F):5'- CGGCAGTCTCCTTCGTAG -3'
(R):5'- ATTTGACCCACCGAGATGTG -3'
Posted On2013-05-09