Incidental Mutation 'R4660:Try10'
ID352763
Institutional Source Beutler Lab
Gene Symbol Try10
Ensembl Gene ENSMUSG00000071521
Gene Nametrypsin 10
Synonymstrypsinogen 10
MMRRC Submission 041920-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R4660 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location41354105-41357914 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 41357827 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 229 (Y229C)
Ref Sequence ENSEMBL: ENSMUSP00000071976 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072103]
Predicted Effect probably damaging
Transcript: ENSMUST00000072103
AA Change: Y229C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071976
Gene: ENSMUSG00000071521
AA Change: Y229C

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
Tryp_SPc 23 239 3.38e-104 SMART
Meta Mutation Damage Score 0.244 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 96% (102/106)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a trypsinogen, which is a member of the trypsin family of serine proteases. This enzyme is secreted by the pancreas and cleaved to its active form in the small intestine. It is active on peptide linkages involving the carboxyl group of lysine or arginine. Mutations in this gene are associated with hereditary pancreatitis. This gene and several other trypsinogen genes are localized to the T cell receptor beta locus on chromosome 7. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adra1d T C 2: 131,561,142 T343A probably damaging Het
Angptl4 A T 17: 33,777,275 probably benign Het
Antxr2 A T 5: 98,004,054 probably null Het
Ap1b1 T A 11: 5,016,760 V145E probably damaging Het
Armc4 A G 18: 7,211,609 V755A possibly damaging Het
Asns G T 6: 7,678,012 N355K probably benign Het
Asxl3 A G 18: 22,516,477 T508A probably benign Het
B4galt7 T A 13: 55,604,298 V54D possibly damaging Het
Bach2 C T 4: 32,562,777 P415S probably benign Het
Bbs9 G A 9: 22,578,767 R278Q probably benign Het
Blzf1 C T 1: 164,306,493 probably benign Het
Btd A T 14: 31,667,803 T494S probably benign Het
Casp9 C T 4: 141,813,623 T434I probably benign Het
Cavin2 T C 1: 51,301,351 S396P probably benign Het
Ccnk C T 12: 108,202,316 probably benign Het
Cldn8 G A 16: 88,562,408 H210Y probably benign Het
Clip1 G A 5: 123,579,374 T1284I probably damaging Het
Coch T C 12: 51,595,485 V80A probably benign Het
Cttnbp2 A G 6: 18,406,537 S1052P probably benign Het
Cyp2j7 C T 4: 96,195,342 R457K probably benign Het
Dalrd3 T C 9: 108,570,369 S129P probably benign Het
Ddx10 A G 9: 53,236,398 probably null Het
Dnah7b A T 1: 46,289,536 T3143S probably damaging Het
Dynlt1b A G 17: 6,431,880 T10A probably benign Het
Eif2s2 G A 2: 154,888,269 T36I probably benign Het
Fam118b A T 9: 35,235,255 H105Q possibly damaging Het
Galntl5 T A 5: 25,203,379 I250N probably damaging Het
Gm11544 C T 11: 94,845,480 noncoding transcript Het
Gm13084 A G 4: 143,811,865 S179P probably benign Het
Gm13088 T A 4: 143,654,277 Y392F probably benign Het
Gm5709 C T 3: 59,618,703 noncoding transcript Het
Golgb1 T A 16: 36,887,618 I107N probably damaging Het
Gpld1 T C 13: 24,982,603 probably null Het
Grik1 T A 16: 87,923,131 T768S probably damaging Het
H2-T23 T G 17: 36,030,216 Q349P probably damaging Het
Ing3 A T 6: 21,973,711 probably benign Het
Iqgap3 T G 3: 88,120,176 L702R probably damaging Het
Itga8 A G 2: 12,265,258 V139A probably damaging Het
Jam2 G A 16: 84,812,952 V151M probably damaging Het
Kbtbd12 T C 6: 88,617,790 I353V probably benign Het
Kif27 T C 13: 58,323,916 E786G probably damaging Het
Lingo4 T A 3: 94,403,365 S537T probably benign Het
Lipo3 C T 19: 33,620,960 probably benign Het
Lrrc3 G T 10: 77,894,032 probably benign Het
Ltbp3 T A 19: 5,748,786 probably null Het
Lyg1 T A 1: 37,946,861 probably benign Het
Mcm9 T C 10: 53,548,527 I656V probably benign Het
Mfsd8 T A 3: 40,821,937 I427F probably benign Het
Mga T A 2: 119,938,623 probably benign Het
Miga1 A G 3: 152,287,518 L422P probably damaging Het
Msantd3 A G 4: 48,552,536 I42V probably benign Het
Mybbp1a T C 11: 72,445,712 V510A probably benign Het
Nccrp1 G T 7: 28,546,335 P135T probably damaging Het
Neb T A 2: 52,255,588 M2975L possibly damaging Het
Nfxl1 A T 5: 72,552,668 I171N probably damaging Het
Olfr1419 T C 19: 11,871,048 H56R possibly damaging Het
Olfr525 T C 7: 140,323,412 F238L possibly damaging Het
Olfr536 A T 7: 140,504,020 F146L probably benign Het
Otop1 T G 5: 38,300,024 S376A possibly damaging Het
Pdgfra T C 5: 75,162,271 V10A possibly damaging Het
Pgs1 T C 11: 118,019,677 V538A probably damaging Het
Ppa2 A T 3: 133,326,684 T97S probably damaging Het
Prdm10 G A 9: 31,327,328 C172Y probably damaging Het
Prrc2c G A 1: 162,680,895 P1091L probably damaging Het
Pthlh G A 6: 147,257,298 R55C probably damaging Het
Ptpn9 A T 9: 57,036,498 T105S probably benign Het
Rundc1 T A 11: 101,434,004 V512E possibly damaging Het
Scrib G A 15: 76,065,336 S307L probably damaging Het
Sec23ip A G 7: 128,750,286 S26G probably null Het
Sec61a2 A G 2: 5,873,693 probably benign Het
Sema3c T C 5: 17,672,513 V206A probably damaging Het
Sgk2 C T 2: 162,997,843 H124Y possibly damaging Het
Slc26a6 C T 9: 108,861,341 T592I probably damaging Het
Slc5a11 T C 7: 123,265,263 Y361H probably damaging Het
Smc6 T C 12: 11,274,007 V51A probably damaging Het
Stab1 A T 14: 31,154,915 N817K possibly damaging Het
Swt1 A T 1: 151,407,597 D336E probably benign Het
Taf13 T A 3: 108,572,977 probably benign Het
Tmub2 T C 11: 102,285,019 probably benign Het
Tnf A G 17: 35,200,180 S209P probably benign Het
Ttbk1 G T 17: 46,477,788 Y183* probably null Het
Ttc17 A T 2: 94,364,429 I533N possibly damaging Het
Tubb6 C T 18: 67,401,946 P305L probably damaging Het
Tulp3 G A 6: 128,323,054 probably benign Het
Usp9x A G X: 13,123,508 R776G possibly damaging Het
Virma T C 4: 11,513,505 V453A probably damaging Het
Vmn2r103 A T 17: 19,811,815 N617I probably damaging Het
Xirp1 G T 9: 120,016,992 L942M probably damaging Het
Zc3h7b T G 15: 81,792,250 V731G probably benign Het
Zfp534 C T 4: 147,674,718 G498D probably benign Het
Zfp639 T C 3: 32,520,530 Y435H probably damaging Het
Zxdc A G 6: 90,378,838 H443R probably damaging Het
Other mutations in Try10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02001:Try10 APN 6 41356589 missense probably benign 0.00
IGL02608:Try10 APN 6 41355487 missense probably damaging 1.00
IGL03280:Try10 APN 6 41354220 missense probably benign 0.18
R0332:Try10 UTSW 6 41354220 missense probably benign 0.18
R1628:Try10 UTSW 6 41357456 missense probably damaging 1.00
R2149:Try10 UTSW 6 41356561 missense probably benign 0.02
R2471:Try10 UTSW 6 41356746 missense probably damaging 1.00
R3764:Try10 UTSW 6 41356524 missense probably benign 0.07
R4008:Try10 UTSW 6 41356674 missense probably benign 0.00
R4792:Try10 UTSW 6 41355452 missense probably benign 0.33
R5185:Try10 UTSW 6 41356549 missense probably damaging 0.96
R6103:Try10 UTSW 6 41356550 missense probably damaging 0.98
R6301:Try10 UTSW 6 41355589 missense probably benign 0.30
R6692:Try10 UTSW 6 41357821 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAAGCATGGCTAGAATGGC -3'
(R):5'- ACATATATGGAGCTGTAGGATGC -3'

Sequencing Primer
(F):5'- CTAGAATGGCATCTTCAGGTCAG -3'
(R):5'- AGCTGTAGGATGCTTGTCACATATC -3'
Posted On2015-10-08