Incidental Mutation 'R4660:Sec23ip'
ID352772
Institutional Source Beutler Lab
Gene Symbol Sec23ip
Ensembl Gene ENSMUSG00000055319
Gene NameSec23 interacting protein
SynonymsD7Ertd373e, p125
MMRRC Submission 041920-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.583) question?
Stock #R4660 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location128744943-128784836 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 128750286 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 26 (S26G)
Ref Sequence ENSEMBL: ENSMUSP00000145911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042942] [ENSMUST00000206986]
Predicted Effect probably benign
Transcript: ENSMUST00000042942
AA Change: S129G

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000035610
Gene: ENSMUSG00000055319
AA Change: S129G

DomainStartEndE-ValueType
low complexity region 8 26 N/A INTRINSIC
low complexity region 41 51 N/A INTRINSIC
low complexity region 79 88 N/A INTRINSIC
low complexity region 203 215 N/A INTRINSIC
low complexity region 222 230 N/A INTRINSIC
Blast:DDHD 513 585 8e-33 BLAST
SAM 637 702 2.18e-9 SMART
DDHD 777 987 1.33e-74 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205856
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206504
Predicted Effect probably null
Transcript: ENSMUST00000206986
AA Change: S26G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Meta Mutation Damage Score 0.128 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 96% (102/106)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the phosphatidic acid preferring-phospholipase A1 family. The encoded protein is localized to endoplasmic reticulum exit sites and plays a critical role in ER-Golgi transport as part of the multimeric coat protein II complex. An orthologous gene in frogs is required for normal neural crest cell development, suggesting that this gene may play a role in Waardenburg syndrome neural crest defects. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Male mice homozygous for a null allele display reduced fertility with globozoospermia and impaired fertilization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adra1d T C 2: 131,561,142 T343A probably damaging Het
Angptl4 A T 17: 33,777,275 probably benign Het
Antxr2 A T 5: 98,004,054 probably null Het
Ap1b1 T A 11: 5,016,760 V145E probably damaging Het
Armc4 A G 18: 7,211,609 V755A possibly damaging Het
Asns G T 6: 7,678,012 N355K probably benign Het
Asxl3 A G 18: 22,516,477 T508A probably benign Het
B4galt7 T A 13: 55,604,298 V54D possibly damaging Het
Bach2 C T 4: 32,562,777 P415S probably benign Het
Bbs9 G A 9: 22,578,767 R278Q probably benign Het
Blzf1 C T 1: 164,306,493 probably benign Het
Btd A T 14: 31,667,803 T494S probably benign Het
Casp9 C T 4: 141,813,623 T434I probably benign Het
Cavin2 T C 1: 51,301,351 S396P probably benign Het
Ccnk C T 12: 108,202,316 probably benign Het
Cldn8 G A 16: 88,562,408 H210Y probably benign Het
Clip1 G A 5: 123,579,374 T1284I probably damaging Het
Coch T C 12: 51,595,485 V80A probably benign Het
Cttnbp2 A G 6: 18,406,537 S1052P probably benign Het
Cyp2j7 C T 4: 96,195,342 R457K probably benign Het
Dalrd3 T C 9: 108,570,369 S129P probably benign Het
Ddx10 A G 9: 53,236,398 probably null Het
Dnah7b A T 1: 46,289,536 T3143S probably damaging Het
Dynlt1b A G 17: 6,431,880 T10A probably benign Het
Eif2s2 G A 2: 154,888,269 T36I probably benign Het
Fam118b A T 9: 35,235,255 H105Q possibly damaging Het
Galntl5 T A 5: 25,203,379 I250N probably damaging Het
Gm11544 C T 11: 94,845,480 noncoding transcript Het
Gm13084 A G 4: 143,811,865 S179P probably benign Het
Gm13088 T A 4: 143,654,277 Y392F probably benign Het
Gm5709 C T 3: 59,618,703 noncoding transcript Het
Golgb1 T A 16: 36,887,618 I107N probably damaging Het
Gpld1 T C 13: 24,982,603 probably null Het
Grik1 T A 16: 87,923,131 T768S probably damaging Het
H2-T23 T G 17: 36,030,216 Q349P probably damaging Het
Ing3 A T 6: 21,973,711 probably benign Het
Iqgap3 T G 3: 88,120,176 L702R probably damaging Het
Itga8 A G 2: 12,265,258 V139A probably damaging Het
Jam2 G A 16: 84,812,952 V151M probably damaging Het
Kbtbd12 T C 6: 88,617,790 I353V probably benign Het
Kif27 T C 13: 58,323,916 E786G probably damaging Het
Lingo4 T A 3: 94,403,365 S537T probably benign Het
Lipo3 C T 19: 33,620,960 probably benign Het
Lrrc3 G T 10: 77,894,032 probably benign Het
Ltbp3 T A 19: 5,748,786 probably null Het
Lyg1 T A 1: 37,946,861 probably benign Het
Mcm9 T C 10: 53,548,527 I656V probably benign Het
Mfsd8 T A 3: 40,821,937 I427F probably benign Het
Mga T A 2: 119,938,623 probably benign Het
Miga1 A G 3: 152,287,518 L422P probably damaging Het
Msantd3 A G 4: 48,552,536 I42V probably benign Het
Mybbp1a T C 11: 72,445,712 V510A probably benign Het
Nccrp1 G T 7: 28,546,335 P135T probably damaging Het
Neb T A 2: 52,255,588 M2975L possibly damaging Het
Nfxl1 A T 5: 72,552,668 I171N probably damaging Het
Olfr1419 T C 19: 11,871,048 H56R possibly damaging Het
Olfr525 T C 7: 140,323,412 F238L possibly damaging Het
Olfr536 A T 7: 140,504,020 F146L probably benign Het
Otop1 T G 5: 38,300,024 S376A possibly damaging Het
Pdgfra T C 5: 75,162,271 V10A possibly damaging Het
Pgs1 T C 11: 118,019,677 V538A probably damaging Het
Ppa2 A T 3: 133,326,684 T97S probably damaging Het
Prdm10 G A 9: 31,327,328 C172Y probably damaging Het
Prrc2c G A 1: 162,680,895 P1091L probably damaging Het
Pthlh G A 6: 147,257,298 R55C probably damaging Het
Ptpn9 A T 9: 57,036,498 T105S probably benign Het
Rundc1 T A 11: 101,434,004 V512E possibly damaging Het
Scrib G A 15: 76,065,336 S307L probably damaging Het
Sec61a2 A G 2: 5,873,693 probably benign Het
Sema3c T C 5: 17,672,513 V206A probably damaging Het
Sgk2 C T 2: 162,997,843 H124Y possibly damaging Het
Slc26a6 C T 9: 108,861,341 T592I probably damaging Het
Slc5a11 T C 7: 123,265,263 Y361H probably damaging Het
Smc6 T C 12: 11,274,007 V51A probably damaging Het
Stab1 A T 14: 31,154,915 N817K possibly damaging Het
Swt1 A T 1: 151,407,597 D336E probably benign Het
Taf13 T A 3: 108,572,977 probably benign Het
Tmub2 T C 11: 102,285,019 probably benign Het
Tnf A G 17: 35,200,180 S209P probably benign Het
Try10 A G 6: 41,357,827 Y229C probably damaging Het
Ttbk1 G T 17: 46,477,788 Y183* probably null Het
Ttc17 A T 2: 94,364,429 I533N possibly damaging Het
Tubb6 C T 18: 67,401,946 P305L probably damaging Het
Tulp3 G A 6: 128,323,054 probably benign Het
Usp9x A G X: 13,123,508 R776G possibly damaging Het
Virma T C 4: 11,513,505 V453A probably damaging Het
Vmn2r103 A T 17: 19,811,815 N617I probably damaging Het
Xirp1 G T 9: 120,016,992 L942M probably damaging Het
Zc3h7b T G 15: 81,792,250 V731G probably benign Het
Zfp534 C T 4: 147,674,718 G498D probably benign Het
Zfp639 T C 3: 32,520,530 Y435H probably damaging Het
Zxdc A G 6: 90,378,838 H443R probably damaging Het
Other mutations in Sec23ip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00825:Sec23ip APN 7 128767609 missense probably damaging 1.00
IGL01347:Sec23ip APN 7 128762405 missense probably benign 0.08
IGL01358:Sec23ip APN 7 128752797 missense possibly damaging 0.68
IGL01656:Sec23ip APN 7 128750245 missense probably damaging 1.00
IGL01835:Sec23ip APN 7 128755311 splice site probably null
IGL02233:Sec23ip APN 7 128779179 missense probably damaging 1.00
IGL02499:Sec23ip APN 7 128776916 missense probably damaging 1.00
IGL03381:Sec23ip APN 7 128750305 missense probably damaging 0.97
R0053:Sec23ip UTSW 7 128745167 missense probably damaging 1.00
R0147:Sec23ip UTSW 7 128779051 splice site probably benign
R0360:Sec23ip UTSW 7 128761405 splice site probably benign
R1427:Sec23ip UTSW 7 128776885 missense probably damaging 0.99
R1442:Sec23ip UTSW 7 128776786 missense probably benign 0.10
R1462:Sec23ip UTSW 7 128766138 missense probably benign
R1462:Sec23ip UTSW 7 128766138 missense probably benign
R1564:Sec23ip UTSW 7 128766281 splice site probably null
R1876:Sec23ip UTSW 7 128752851 missense probably benign
R1966:Sec23ip UTSW 7 128755353 missense probably damaging 0.98
R1977:Sec23ip UTSW 7 128766273 missense probably damaging 1.00
R2115:Sec23ip UTSW 7 128762461 missense probably benign 0.00
R2847:Sec23ip UTSW 7 128754073 missense probably benign 0.00
R3958:Sec23ip UTSW 7 128776850 missense probably benign 0.35
R3959:Sec23ip UTSW 7 128776850 missense probably benign 0.35
R3960:Sec23ip UTSW 7 128776850 missense probably benign 0.35
R4287:Sec23ip UTSW 7 128777333 missense probably benign 0.37
R4510:Sec23ip UTSW 7 128779176 missense probably damaging 1.00
R4511:Sec23ip UTSW 7 128779176 missense probably damaging 1.00
R4612:Sec23ip UTSW 7 128750502 nonsense probably null
R4890:Sec23ip UTSW 7 128752910 missense probably damaging 0.98
R5287:Sec23ip UTSW 7 128766136 missense probably benign
R5587:Sec23ip UTSW 7 128750427 missense probably benign
R5625:Sec23ip UTSW 7 128744983 unclassified probably benign
R5656:Sec23ip UTSW 7 128776784 missense probably damaging 1.00
R5808:Sec23ip UTSW 7 128772184 missense probably benign 0.00
R6034:Sec23ip UTSW 7 128750203 missense possibly damaging 0.66
R6034:Sec23ip UTSW 7 128750203 missense possibly damaging 0.66
R6145:Sec23ip UTSW 7 128778484 missense probably damaging 0.99
R6747:Sec23ip UTSW 7 128752849 synonymous silent
R6953:Sec23ip UTSW 7 128752796 nonsense probably null
R6992:Sec23ip UTSW 7 128765440 missense probably benign
R7131:Sec23ip UTSW 7 128779640 missense probably damaging 1.00
R7163:Sec23ip UTSW 7 128762533 critical splice donor site probably null
R7387:Sec23ip UTSW 7 128745003 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GGTCAGACTTCTACTCACACATC -3'
(R):5'- TGGCATCTGACACTGCTGTAG -3'

Sequencing Primer
(F):5'- GACTTCTACTCACACATCCACGC -3'
(R):5'- TTTGCCCGGCTGCTGAC -3'
Posted On2015-10-08