Incidental Mutation 'R4660:Tmub2'
ID352789
Institutional Source Beutler Lab
Gene Symbol Tmub2
Ensembl Gene ENSMUSG00000034757
Gene Nametransmembrane and ubiquitin-like domain containing 2
Synonyms
MMRRC Submission 041920-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.183) question?
Stock #R4660 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location102284931-102289237 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 102285019 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116327 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036376] [ENSMUST00000073234] [ENSMUST00000107132] [ENSMUST00000107134] [ENSMUST00000137387] [ENSMUST00000156326]
Predicted Effect probably benign
Transcript: ENSMUST00000036376
SMART Domains Protein: ENSMUSP00000047600
Gene: ENSMUSG00000034757

DomainStartEndE-ValueType
transmembrane domain 36 58 N/A INTRINSIC
UBQ 173 242 1.75e-9 SMART
transmembrane domain 264 286 N/A INTRINSIC
transmembrane domain 296 318 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000073234
SMART Domains Protein: ENSMUSP00000072967
Gene: ENSMUSG00000059995

DomainStartEndE-ValueType
Pfam:Sgf11 80 112 1.3e-21 PFAM
low complexity region 135 143 N/A INTRINSIC
low complexity region 150 159 N/A INTRINSIC
Pfam:SCA7 202 239 8.8e-10 PFAM
low complexity region 275 288 N/A INTRINSIC
low complexity region 302 316 N/A INTRINSIC
low complexity region 328 338 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000100387
AA Change: L27P
SMART Domains Protein: ENSMUSP00000097956
Gene: ENSMUSG00000034757
AA Change: L27P

DomainStartEndE-ValueType
low complexity region 21 35 N/A INTRINSIC
transmembrane domain 75 97 N/A INTRINSIC
UBQ 212 281 1.75e-9 SMART
transmembrane domain 303 325 N/A INTRINSIC
transmembrane domain 335 357 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107132
SMART Domains Protein: ENSMUSP00000102750
Gene: ENSMUSG00000059995

DomainStartEndE-ValueType
Pfam:Sgf11 80 112 1.1e-21 PFAM
low complexity region 135 143 N/A INTRINSIC
low complexity region 150 159 N/A INTRINSIC
Pfam:SCA7 209 246 7.8e-11 PFAM
low complexity region 282 295 N/A INTRINSIC
low complexity region 309 323 N/A INTRINSIC
low complexity region 335 345 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107134
SMART Domains Protein: ENSMUSP00000102752
Gene: ENSMUSG00000059995

DomainStartEndE-ValueType
Pfam:Sgf11 80 112 1.3e-21 PFAM
low complexity region 135 143 N/A INTRINSIC
low complexity region 150 159 N/A INTRINSIC
Pfam:SCA7 202 239 8.8e-10 PFAM
low complexity region 275 288 N/A INTRINSIC
low complexity region 302 316 N/A INTRINSIC
low complexity region 328 338 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135551
Predicted Effect probably benign
Transcript: ENSMUST00000137387
SMART Domains Protein: ENSMUSP00000122610
Gene: ENSMUSG00000059995

DomainStartEndE-ValueType
Pfam:Sgf11 76 108 2.6e-21 PFAM
low complexity region 131 139 N/A INTRINSIC
low complexity region 146 155 N/A INTRINSIC
Pfam:SCA7 205 242 1.9e-9 PFAM
low complexity region 278 291 N/A INTRINSIC
low complexity region 305 319 N/A INTRINSIC
low complexity region 331 341 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141516
SMART Domains Protein: ENSMUSP00000121917
Gene: ENSMUSG00000059995

DomainStartEndE-ValueType
low complexity region 1 17 N/A INTRINSIC
low complexity region 27 35 N/A INTRINSIC
low complexity region 42 51 N/A INTRINSIC
Pfam:SCA7 113 150 6.7e-11 PFAM
low complexity region 186 199 N/A INTRINSIC
low complexity region 213 227 N/A INTRINSIC
low complexity region 239 249 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145484
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156077
Predicted Effect probably benign
Transcript: ENSMUST00000156326
SMART Domains Protein: ENSMUSP00000116327
Gene: ENSMUSG00000034757

DomainStartEndE-ValueType
transmembrane domain 36 58 N/A INTRINSIC
UBQ 173 242 1.75e-9 SMART
transmembrane domain 264 286 N/A INTRINSIC
transmembrane domain 296 318 N/A INTRINSIC
Meta Mutation Damage Score 0.0628 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 96% (102/106)
MGI Phenotype FUNCTION: This gene encodes a predicted multi-pass membrane protein that features a C-terminal ubiquitin-related domain. This gene may be expressed in cone photoreceptors in the retina. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adra1d T C 2: 131,561,142 T343A probably damaging Het
Angptl4 A T 17: 33,777,275 probably benign Het
Antxr2 A T 5: 98,004,054 probably null Het
Ap1b1 T A 11: 5,016,760 V145E probably damaging Het
Armc4 A G 18: 7,211,609 V755A possibly damaging Het
Asns G T 6: 7,678,012 N355K probably benign Het
Asxl3 A G 18: 22,516,477 T508A probably benign Het
B4galt7 T A 13: 55,604,298 V54D possibly damaging Het
Bach2 C T 4: 32,562,777 P415S probably benign Het
Bbs9 G A 9: 22,578,767 R278Q probably benign Het
Blzf1 C T 1: 164,306,493 probably benign Het
Btd A T 14: 31,667,803 T494S probably benign Het
Casp9 C T 4: 141,813,623 T434I probably benign Het
Cavin2 T C 1: 51,301,351 S396P probably benign Het
Ccnk C T 12: 108,202,316 probably benign Het
Cldn8 G A 16: 88,562,408 H210Y probably benign Het
Clip1 G A 5: 123,579,374 T1284I probably damaging Het
Coch T C 12: 51,595,485 V80A probably benign Het
Cttnbp2 A G 6: 18,406,537 S1052P probably benign Het
Cyp2j7 C T 4: 96,195,342 R457K probably benign Het
Dalrd3 T C 9: 108,570,369 S129P probably benign Het
Ddx10 A G 9: 53,236,398 probably null Het
Dnah7b A T 1: 46,289,536 T3143S probably damaging Het
Dynlt1b A G 17: 6,431,880 T10A probably benign Het
Eif2s2 G A 2: 154,888,269 T36I probably benign Het
Fam118b A T 9: 35,235,255 H105Q possibly damaging Het
Galntl5 T A 5: 25,203,379 I250N probably damaging Het
Gm11544 C T 11: 94,845,480 noncoding transcript Het
Gm13084 A G 4: 143,811,865 S179P probably benign Het
Gm13088 T A 4: 143,654,277 Y392F probably benign Het
Gm5709 C T 3: 59,618,703 noncoding transcript Het
Golgb1 T A 16: 36,887,618 I107N probably damaging Het
Gpld1 T C 13: 24,982,603 probably null Het
Grik1 T A 16: 87,923,131 T768S probably damaging Het
H2-T23 T G 17: 36,030,216 Q349P probably damaging Het
Ing3 A T 6: 21,973,711 probably benign Het
Iqgap3 T G 3: 88,120,176 L702R probably damaging Het
Itga8 A G 2: 12,265,258 V139A probably damaging Het
Jam2 G A 16: 84,812,952 V151M probably damaging Het
Kbtbd12 T C 6: 88,617,790 I353V probably benign Het
Kif27 T C 13: 58,323,916 E786G probably damaging Het
Lingo4 T A 3: 94,403,365 S537T probably benign Het
Lipo3 C T 19: 33,620,960 probably benign Het
Lrrc3 G T 10: 77,894,032 probably benign Het
Ltbp3 T A 19: 5,748,786 probably null Het
Lyg1 T A 1: 37,946,861 probably benign Het
Mcm9 T C 10: 53,548,527 I656V probably benign Het
Mfsd8 T A 3: 40,821,937 I427F probably benign Het
Mga T A 2: 119,938,623 probably benign Het
Miga1 A G 3: 152,287,518 L422P probably damaging Het
Msantd3 A G 4: 48,552,536 I42V probably benign Het
Mybbp1a T C 11: 72,445,712 V510A probably benign Het
Nccrp1 G T 7: 28,546,335 P135T probably damaging Het
Neb T A 2: 52,255,588 M2975L possibly damaging Het
Nfxl1 A T 5: 72,552,668 I171N probably damaging Het
Olfr1419 T C 19: 11,871,048 H56R possibly damaging Het
Olfr525 T C 7: 140,323,412 F238L possibly damaging Het
Olfr536 A T 7: 140,504,020 F146L probably benign Het
Otop1 T G 5: 38,300,024 S376A possibly damaging Het
Pdgfra T C 5: 75,162,271 V10A possibly damaging Het
Pgs1 T C 11: 118,019,677 V538A probably damaging Het
Ppa2 A T 3: 133,326,684 T97S probably damaging Het
Prdm10 G A 9: 31,327,328 C172Y probably damaging Het
Prrc2c G A 1: 162,680,895 P1091L probably damaging Het
Pthlh G A 6: 147,257,298 R55C probably damaging Het
Ptpn9 A T 9: 57,036,498 T105S probably benign Het
Rundc1 T A 11: 101,434,004 V512E possibly damaging Het
Scrib G A 15: 76,065,336 S307L probably damaging Het
Sec23ip A G 7: 128,750,286 S26G probably null Het
Sec61a2 A G 2: 5,873,693 probably benign Het
Sema3c T C 5: 17,672,513 V206A probably damaging Het
Sgk2 C T 2: 162,997,843 H124Y possibly damaging Het
Slc26a6 C T 9: 108,861,341 T592I probably damaging Het
Slc5a11 T C 7: 123,265,263 Y361H probably damaging Het
Smc6 T C 12: 11,274,007 V51A probably damaging Het
Stab1 A T 14: 31,154,915 N817K possibly damaging Het
Swt1 A T 1: 151,407,597 D336E probably benign Het
Taf13 T A 3: 108,572,977 probably benign Het
Tnf A G 17: 35,200,180 S209P probably benign Het
Try10 A G 6: 41,357,827 Y229C probably damaging Het
Ttbk1 G T 17: 46,477,788 Y183* probably null Het
Ttc17 A T 2: 94,364,429 I533N possibly damaging Het
Tubb6 C T 18: 67,401,946 P305L probably damaging Het
Tulp3 G A 6: 128,323,054 probably benign Het
Usp9x A G X: 13,123,508 R776G possibly damaging Het
Virma T C 4: 11,513,505 V453A probably damaging Het
Vmn2r103 A T 17: 19,811,815 N617I probably damaging Het
Xirp1 G T 9: 120,016,992 L942M probably damaging Het
Zc3h7b T G 15: 81,792,250 V731G probably benign Het
Zfp534 C T 4: 147,674,718 G498D probably benign Het
Zfp639 T C 3: 32,520,530 Y435H probably damaging Het
Zxdc A G 6: 90,378,838 H443R probably damaging Het
Other mutations in Tmub2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0115:Tmub2 UTSW 11 102288375 unclassified probably null
R0332:Tmub2 UTSW 11 102288348 missense probably damaging 1.00
R1168:Tmub2 UTSW 11 102287370 missense possibly damaging 0.77
R1530:Tmub2 UTSW 11 102287486 missense probably benign 0.01
R2141:Tmub2 UTSW 11 102287553 missense possibly damaging 0.89
R2420:Tmub2 UTSW 11 102287755 missense probably benign
R2421:Tmub2 UTSW 11 102287755 missense probably benign
R3717:Tmub2 UTSW 11 102285061 unclassified probably benign
R5238:Tmub2 UTSW 11 102284994 unclassified probably benign
R5444:Tmub2 UTSW 11 102288240 missense possibly damaging 0.80
R6590:Tmub2 UTSW 11 102287519 missense probably damaging 1.00
R6690:Tmub2 UTSW 11 102287519 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGGGCGTGGTCTTACTGC -3'
(R):5'- CCGGGACAGTGATGGTTTAG -3'

Sequencing Primer
(F):5'- CGTGGTCTTACTGCCGGAG -3'
(R):5'- ACCCCTCAAACTTCGGGG -3'
Posted On2015-10-08