Incidental Mutation 'R4660:Stab1'
ID352798
Institutional Source Beutler Lab
Gene Symbol Stab1
Ensembl Gene ENSMUSG00000042286
Gene Namestabilin 1
SynonymsMS-1
MMRRC Submission 041920-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4660 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location31139013-31168641 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 31154915 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 817 (N817K)
Ref Sequence ENSEMBL: ENSMUSP00000046199 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036618]
Predicted Effect possibly damaging
Transcript: ENSMUST00000036618
AA Change: N817K

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000046199
Gene: ENSMUSG00000042286
AA Change: N817K

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
EGF 112 149 6.65e-2 SMART
EGF 160 194 2.28e0 SMART
EGF 199 232 1.4e0 SMART
EGF 236 272 4.97e-1 SMART
EGF 276 319 1.95e1 SMART
EGF_like 321 357 5.03e1 SMART
low complexity region 400 413 N/A INTRINSIC
Blast:FAS1 414 501 2e-52 BLAST
FAS1 543 645 1.35e-24 SMART
EGF_like 780 817 5.45e1 SMART
EGF 822 861 1.08e-1 SMART
EGF 865 904 3.15e-3 SMART
EGF 908 947 1.3e1 SMART
EGF 951 989 1.47e1 SMART
FAS1 1023 1122 1.3e-17 SMART
FAS1 1165 1257 2.94e0 SMART
EGF 1332 1369 1.4e0 SMART
EGF 1379 1413 1.88e-1 SMART
EGF 1420 1455 6.02e0 SMART
EGF 1459 1497 3.82e-2 SMART
EGF 1501 1540 2.05e-2 SMART
EGF 1544 1583 2.25e1 SMART
FAS1 1616 1712 1.61e-22 SMART
FAS1 1763 1868 2.12e-17 SMART
EGF 1970 2007 1.26e-2 SMART
EGF 2017 2051 1.61e0 SMART
EGF 2059 2090 2.45e0 SMART
EGF 2094 2131 3.46e0 SMART
EGF 2135 2174 3.82e-2 SMART
LINK 2206 2301 8.55e-49 SMART
FAS1 2367 2462 2.06e-6 SMART
transmembrane domain 2476 2498 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159532
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159757
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161464
Meta Mutation Damage Score 0.0652 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 96% (102/106)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large, transmembrane receptor protein which may function in angiogenesis, lymphocyte homing, cell adhesion, or receptor scavenging. The protein contains 7 fasciclin, 16 epidermal growth factor (EGF)-like, and 2 laminin-type EGF-like domains as well as a C-type lectin-like hyaluronan-binding Link module. The protein is primarily expressed on sinusoidal endothelial cells of liver, spleen, and lymph node. The receptor has been shown to endocytose ligands such as low density lipoprotein, Gram-positive and Gram-negative bacteria, and advanced glycosylation end products. Supporting its possible role as a scavenger receptor, the protein rapidly cycles between the plasma membrane and early endosomes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit no physical or behavioral abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adra1d T C 2: 131,561,142 T343A probably damaging Het
Angptl4 A T 17: 33,777,275 probably benign Het
Antxr2 A T 5: 98,004,054 probably null Het
Ap1b1 T A 11: 5,016,760 V145E probably damaging Het
Armc4 A G 18: 7,211,609 V755A possibly damaging Het
Asns G T 6: 7,678,012 N355K probably benign Het
Asxl3 A G 18: 22,516,477 T508A probably benign Het
B4galt7 T A 13: 55,604,298 V54D possibly damaging Het
Bach2 C T 4: 32,562,777 P415S probably benign Het
Bbs9 G A 9: 22,578,767 R278Q probably benign Het
Blzf1 C T 1: 164,306,493 probably benign Het
Btd A T 14: 31,667,803 T494S probably benign Het
Casp9 C T 4: 141,813,623 T434I probably benign Het
Cavin2 T C 1: 51,301,351 S396P probably benign Het
Ccnk C T 12: 108,202,316 probably benign Het
Cldn8 G A 16: 88,562,408 H210Y probably benign Het
Clip1 G A 5: 123,579,374 T1284I probably damaging Het
Coch T C 12: 51,595,485 V80A probably benign Het
Cttnbp2 A G 6: 18,406,537 S1052P probably benign Het
Cyp2j7 C T 4: 96,195,342 R457K probably benign Het
Dalrd3 T C 9: 108,570,369 S129P probably benign Het
Ddx10 A G 9: 53,236,398 probably null Het
Dnah7b A T 1: 46,289,536 T3143S probably damaging Het
Dynlt1b A G 17: 6,431,880 T10A probably benign Het
Eif2s2 G A 2: 154,888,269 T36I probably benign Het
Fam118b A T 9: 35,235,255 H105Q possibly damaging Het
Galntl5 T A 5: 25,203,379 I250N probably damaging Het
Gm11544 C T 11: 94,845,480 noncoding transcript Het
Gm13084 A G 4: 143,811,865 S179P probably benign Het
Gm13088 T A 4: 143,654,277 Y392F probably benign Het
Gm5709 C T 3: 59,618,703 noncoding transcript Het
Golgb1 T A 16: 36,887,618 I107N probably damaging Het
Gpld1 T C 13: 24,982,603 probably null Het
Grik1 T A 16: 87,923,131 T768S probably damaging Het
H2-T23 T G 17: 36,030,216 Q349P probably damaging Het
Ing3 A T 6: 21,973,711 probably benign Het
Iqgap3 T G 3: 88,120,176 L702R probably damaging Het
Itga8 A G 2: 12,265,258 V139A probably damaging Het
Jam2 G A 16: 84,812,952 V151M probably damaging Het
Kbtbd12 T C 6: 88,617,790 I353V probably benign Het
Kif27 T C 13: 58,323,916 E786G probably damaging Het
Lingo4 T A 3: 94,403,365 S537T probably benign Het
Lipo3 C T 19: 33,620,960 probably benign Het
Lrrc3 G T 10: 77,894,032 probably benign Het
Ltbp3 T A 19: 5,748,786 probably null Het
Lyg1 T A 1: 37,946,861 probably benign Het
Mcm9 T C 10: 53,548,527 I656V probably benign Het
Mfsd8 T A 3: 40,821,937 I427F probably benign Het
Mga T A 2: 119,938,623 probably benign Het
Miga1 A G 3: 152,287,518 L422P probably damaging Het
Msantd3 A G 4: 48,552,536 I42V probably benign Het
Mybbp1a T C 11: 72,445,712 V510A probably benign Het
Nccrp1 G T 7: 28,546,335 P135T probably damaging Het
Neb T A 2: 52,255,588 M2975L possibly damaging Het
Nfxl1 A T 5: 72,552,668 I171N probably damaging Het
Olfr1419 T C 19: 11,871,048 H56R possibly damaging Het
Olfr525 T C 7: 140,323,412 F238L possibly damaging Het
Olfr536 A T 7: 140,504,020 F146L probably benign Het
Otop1 T G 5: 38,300,024 S376A possibly damaging Het
Pdgfra T C 5: 75,162,271 V10A possibly damaging Het
Pgs1 T C 11: 118,019,677 V538A probably damaging Het
Ppa2 A T 3: 133,326,684 T97S probably damaging Het
Prdm10 G A 9: 31,327,328 C172Y probably damaging Het
Prrc2c G A 1: 162,680,895 P1091L probably damaging Het
Pthlh G A 6: 147,257,298 R55C probably damaging Het
Ptpn9 A T 9: 57,036,498 T105S probably benign Het
Rundc1 T A 11: 101,434,004 V512E possibly damaging Het
Scrib G A 15: 76,065,336 S307L probably damaging Het
Sec23ip A G 7: 128,750,286 S26G probably null Het
Sec61a2 A G 2: 5,873,693 probably benign Het
Sema3c T C 5: 17,672,513 V206A probably damaging Het
Sgk2 C T 2: 162,997,843 H124Y possibly damaging Het
Slc26a6 C T 9: 108,861,341 T592I probably damaging Het
Slc5a11 T C 7: 123,265,263 Y361H probably damaging Het
Smc6 T C 12: 11,274,007 V51A probably damaging Het
Swt1 A T 1: 151,407,597 D336E probably benign Het
Taf13 T A 3: 108,572,977 probably benign Het
Tmub2 T C 11: 102,285,019 probably benign Het
Tnf A G 17: 35,200,180 S209P probably benign Het
Try10 A G 6: 41,357,827 Y229C probably damaging Het
Ttbk1 G T 17: 46,477,788 Y183* probably null Het
Ttc17 A T 2: 94,364,429 I533N possibly damaging Het
Tubb6 C T 18: 67,401,946 P305L probably damaging Het
Tulp3 G A 6: 128,323,054 probably benign Het
Usp9x A G X: 13,123,508 R776G possibly damaging Het
Virma T C 4: 11,513,505 V453A probably damaging Het
Vmn2r103 A T 17: 19,811,815 N617I probably damaging Het
Xirp1 G T 9: 120,016,992 L942M probably damaging Het
Zc3h7b T G 15: 81,792,250 V731G probably benign Het
Zfp534 C T 4: 147,674,718 G498D probably benign Het
Zfp639 T C 3: 32,520,530 Y435H probably damaging Het
Zxdc A G 6: 90,378,838 H443R probably damaging Het
Other mutations in Stab1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Stab1 APN 14 31161357 missense probably benign 0.01
IGL00323:Stab1 APN 14 31139306 missense probably benign 0.04
IGL00515:Stab1 APN 14 31159729 missense probably benign 0.20
IGL00844:Stab1 APN 14 31147066 missense probably damaging 1.00
IGL01374:Stab1 APN 14 31147075 missense probably damaging 1.00
IGL01384:Stab1 APN 14 31150408 missense probably benign
IGL01431:Stab1 APN 14 31148995 missense probably benign 0.06
IGL01787:Stab1 APN 14 31139808 missense probably damaging 1.00
IGL02128:Stab1 APN 14 31150441 missense probably damaging 1.00
IGL02138:Stab1 APN 14 31143513 critical splice donor site probably null
IGL02256:Stab1 APN 14 31141592 missense probably damaging 1.00
IGL02340:Stab1 APN 14 31140410 missense probably damaging 0.96
IGL02507:Stab1 APN 14 31139210 unclassified probably benign
IGL02695:Stab1 APN 14 31159271 missense probably damaging 1.00
IGL02755:Stab1 APN 14 31139638 missense probably benign 0.01
IGL02870:Stab1 APN 14 31139397 missense probably benign 0.00
IGL02884:Stab1 APN 14 31150143 splice site probably null
IGL03035:Stab1 APN 14 31147769 missense probably benign 0.00
IGL03267:Stab1 APN 14 31142729 missense probably damaging 1.00
IGL03286:Stab1 APN 14 31159326 splice site probably benign
IGL03366:Stab1 APN 14 31150263 missense possibly damaging 0.58
IGL03412:Stab1 APN 14 31154407 missense probably benign 0.42
IGL02835:Stab1 UTSW 14 31146024 critical splice donor site probably null
K7371:Stab1 UTSW 14 31150249 missense probably damaging 1.00
R0053:Stab1 UTSW 14 31140687 missense possibly damaging 0.57
R0053:Stab1 UTSW 14 31140687 missense possibly damaging 0.57
R0066:Stab1 UTSW 14 31157070 splice site probably benign
R0066:Stab1 UTSW 14 31157070 splice site probably benign
R0363:Stab1 UTSW 14 31159008 splice site probably benign
R0387:Stab1 UTSW 14 31148101 missense probably benign 0.00
R0391:Stab1 UTSW 14 31143418 missense probably benign 0.21
R0513:Stab1 UTSW 14 31148945 missense probably benign 0.08
R0546:Stab1 UTSW 14 31139550 missense possibly damaging 0.92
R0825:Stab1 UTSW 14 31152600 missense probably benign 0.16
R0906:Stab1 UTSW 14 31145249 missense probably benign 0.19
R0963:Stab1 UTSW 14 31147274 missense probably damaging 0.97
R1219:Stab1 UTSW 14 31140621 unclassified probably null
R1234:Stab1 UTSW 14 31150236 missense probably damaging 1.00
R1260:Stab1 UTSW 14 31151889 missense probably damaging 1.00
R1400:Stab1 UTSW 14 31139830 missense possibly damaging 0.92
R1405:Stab1 UTSW 14 31149001 missense probably benign 0.19
R1405:Stab1 UTSW 14 31149001 missense probably benign 0.19
R1440:Stab1 UTSW 14 31151690 nonsense probably null
R1472:Stab1 UTSW 14 31141586 missense probably benign 0.01
R1474:Stab1 UTSW 14 31149861 missense probably benign 0.45
R1475:Stab1 UTSW 14 31163828 missense probably benign
R1509:Stab1 UTSW 14 31151584 splice site probably benign
R1551:Stab1 UTSW 14 31160499 missense probably benign 0.00
R1572:Stab1 UTSW 14 31150823 missense probably damaging 1.00
R1633:Stab1 UTSW 14 31150380 intron probably null
R1719:Stab1 UTSW 14 31146028 nonsense probably null
R1733:Stab1 UTSW 14 31145303 missense probably damaging 1.00
R1763:Stab1 UTSW 14 31168416 missense probably benign 0.04
R1808:Stab1 UTSW 14 31141144 missense possibly damaging 0.80
R1816:Stab1 UTSW 14 31157465 missense probably benign 0.03
R1853:Stab1 UTSW 14 31140463 missense probably damaging 1.00
R1891:Stab1 UTSW 14 31141330 missense probably benign 0.07
R1984:Stab1 UTSW 14 31150648 missense probably benign 0.20
R1998:Stab1 UTSW 14 31162153 nonsense probably null
R2165:Stab1 UTSW 14 31168435 missense probably benign 0.20
R2191:Stab1 UTSW 14 31142800 missense probably benign 0.03
R2191:Stab1 UTSW 14 31159270 missense probably damaging 1.00
R2233:Stab1 UTSW 14 31161880 missense probably benign 0.08
R2303:Stab1 UTSW 14 31146070 missense probably damaging 1.00
R2496:Stab1 UTSW 14 31161463 missense probably damaging 1.00
R2504:Stab1 UTSW 14 31163040 critical splice donor site probably null
R2519:Stab1 UTSW 14 31154872 missense probably damaging 1.00
R2926:Stab1 UTSW 14 31161799 missense probably damaging 1.00
R4025:Stab1 UTSW 14 31154952 missense possibly damaging 0.46
R4113:Stab1 UTSW 14 31168479 missense probably damaging 0.98
R4258:Stab1 UTSW 14 31154672 missense possibly damaging 0.92
R4588:Stab1 UTSW 14 31157445 missense probably benign 0.01
R4644:Stab1 UTSW 14 31140487 unclassified probably benign
R4801:Stab1 UTSW 14 31141371 nonsense probably null
R4802:Stab1 UTSW 14 31141371 nonsense probably null
R4870:Stab1 UTSW 14 31142043 missense probably benign 0.13
R4872:Stab1 UTSW 14 31140393 missense probably damaging 1.00
R4881:Stab1 UTSW 14 31143672 missense probably benign 0.32
R4941:Stab1 UTSW 14 31151571 missense probably benign 0.00
R5061:Stab1 UTSW 14 31163099 missense probably damaging 1.00
R5086:Stab1 UTSW 14 31143624 missense probably damaging 1.00
R5086:Stab1 UTSW 14 31159304 missense probably damaging 1.00
R5087:Stab1 UTSW 14 31159304 missense probably damaging 1.00
R5092:Stab1 UTSW 14 31145855 missense probably benign 0.01
R5102:Stab1 UTSW 14 31148017 critical splice donor site probably null
R5107:Stab1 UTSW 14 31163795 splice site probably null
R5195:Stab1 UTSW 14 31140521 unclassified probably benign
R5217:Stab1 UTSW 14 31159519 missense probably benign 0.25
R5285:Stab1 UTSW 14 31143476 unclassified probably benign
R5327:Stab1 UTSW 14 31161836 nonsense probably null
R5647:Stab1 UTSW 14 31157440 nonsense probably null
R5696:Stab1 UTSW 14 31160221 missense probably benign
R5996:Stab1 UTSW 14 31139551 missense probably benign 0.39
R6016:Stab1 UTSW 14 31158993 missense probably damaging 1.00
R6017:Stab1 UTSW 14 31141544 missense probably benign 0.00
R6174:Stab1 UTSW 14 31162519 nonsense probably null
R6366:Stab1 UTSW 14 31141438 missense probably benign 0.10
R6754:Stab1 UTSW 14 31141081 missense probably benign
R6788:Stab1 UTSW 14 31139160 missense probably damaging 1.00
R6898:Stab1 UTSW 14 31158963 missense probably benign 0.00
R7124:Stab1 UTSW 14 31160867 missense possibly damaging 0.94
R7145:Stab1 UTSW 14 31145073 critical splice donor site probably null
R7153:Stab1 UTSW 14 31160584 missense probably benign 0.16
X0026:Stab1 UTSW 14 31162191 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TTCAAAACCATCATGGCAGACG -3'
(R):5'- GAGCTACTCCATTACCAGCC -3'

Sequencing Primer
(F):5'- ATCATGGCAGACGCACCTG -3'
(R):5'- CCTGTACTTTACAAAACAGTCCTGG -3'
Posted On2015-10-08