Incidental Mutation 'R4660:Tnf'
ID352808
Institutional Source Beutler Lab
Gene Symbol Tnf
Ensembl Gene ENSMUSG00000024401
Gene Nametumor necrosis factor
Synonymstumor necrosis factor-alpha, Tnfa, TNF-alpha, TNFalpha, Tnfsf1a, TNF alpha, DIF
MMRRC Submission 041920-MU
Accession Numbers

Ncbi RefSeq: NM_013693; MGI: 104798

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4660 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location35199381-35202007 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35200180 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 209 (S209P)
Ref Sequence ENSEMBL: ENSMUSP00000126122 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025262] [ENSMUST00000025263] [ENSMUST00000025266] [ENSMUST00000167924] [ENSMUST00000173600]
Predicted Effect probably benign
Transcript: ENSMUST00000025262
SMART Domains Protein: ENSMUSP00000025262
Gene: ENSMUSG00000024399

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
low complexity region 72 85 N/A INTRINSIC
TNF 154 305 8.76e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000025263
AA Change: S225P

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000025263
Gene: ENSMUSG00000024401
AA Change: S225P

DomainStartEndE-ValueType
transmembrane domain 35 57 N/A INTRINSIC
TNF 91 235 1.59e-53 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000025266
SMART Domains Protein: ENSMUSP00000025266
Gene: ENSMUSG00000024402

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
TNF 60 202 5.38e-51 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167924
AA Change: S209P

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000126122
Gene: ENSMUSG00000024401
AA Change: S209P

DomainStartEndE-ValueType
transmembrane domain 35 57 N/A INTRINSIC
TNF 74 219 2.8e-49 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173510
Predicted Effect probably benign
Transcript: ENSMUST00000173600
SMART Domains Protein: ENSMUSP00000134706
Gene: ENSMUSG00000024399

DomainStartEndE-ValueType
TNF 33 184 8.76e-42 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184381
Meta Mutation Damage Score 0.08 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 96% (102/106)
MGI Phenotype FUNCTION: This gene encodes a multifunctional proinflammatory cytokine that belongs to the tumor necrosis factor (TNF) superfamily. Members of this family are classified based on primary sequence, function, and structure. This protein is synthesized as a type-II transmembrane protein and is reported to be cleaved into products that exert distinct biological functions. It plays an important role in the innate immune response as well as regulating homeostasis but is also implicated in diseases of chronic inflammation. In mouse deficiency of this gene is associated with defects in response to bacterial infection, with defects in forming organized follicular dendritic cell networks and germinal centers, and with a lack of primary B cell follicles. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2013]
PHENOTYPE: Mutations at this locus primarily affect the immune system, causing increased susceptibility to infection, failure to form splenic B-cell follicles, increased inflammation and impaired contact hypersensitivity. Homozygotes also may show metabolic defects. [provided by MGI curators]
Allele List at MGI

All alleles(23) : Targeted(20) Spontaneous(2) Chemically induced(1)             

Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adra1d T C 2: 131,561,142 T343A probably damaging Het
Angptl4 A T 17: 33,777,275 probably benign Het
Antxr2 A T 5: 98,004,054 probably null Het
Ap1b1 T A 11: 5,016,760 V145E probably damaging Het
Armc4 A G 18: 7,211,609 V755A possibly damaging Het
Asns G T 6: 7,678,012 N355K probably benign Het
Asxl3 A G 18: 22,516,477 T508A probably benign Het
B4galt7 T A 13: 55,604,298 V54D possibly damaging Het
Bach2 C T 4: 32,562,777 P415S probably benign Het
Bbs9 G A 9: 22,578,767 R278Q probably benign Het
Blzf1 C T 1: 164,306,493 probably benign Het
Btd A T 14: 31,667,803 T494S probably benign Het
Casp9 C T 4: 141,813,623 T434I probably benign Het
Cavin2 T C 1: 51,301,351 S396P probably benign Het
Ccnk C T 12: 108,202,316 probably benign Het
Cldn8 G A 16: 88,562,408 H210Y probably benign Het
Clip1 G A 5: 123,579,374 T1284I probably damaging Het
Coch T C 12: 51,595,485 V80A probably benign Het
Cttnbp2 A G 6: 18,406,537 S1052P probably benign Het
Cyp2j7 C T 4: 96,195,342 R457K probably benign Het
Dalrd3 T C 9: 108,570,369 S129P probably benign Het
Ddx10 A G 9: 53,236,398 probably null Het
Dnah7b A T 1: 46,289,536 T3143S probably damaging Het
Dynlt1b A G 17: 6,431,880 T10A probably benign Het
Eif2s2 G A 2: 154,888,269 T36I probably benign Het
Fam118b A T 9: 35,235,255 H105Q possibly damaging Het
Galntl5 T A 5: 25,203,379 I250N probably damaging Het
Gm11544 C T 11: 94,845,480 noncoding transcript Het
Gm13084 A G 4: 143,811,865 S179P probably benign Het
Gm13088 T A 4: 143,654,277 Y392F probably benign Het
Gm5709 C T 3: 59,618,703 noncoding transcript Het
Golgb1 T A 16: 36,887,618 I107N probably damaging Het
Gpld1 T C 13: 24,982,603 probably null Het
Grik1 T A 16: 87,923,131 T768S probably damaging Het
H2-T23 T G 17: 36,030,216 Q349P probably damaging Het
Ing3 A T 6: 21,973,711 probably benign Het
Iqgap3 T G 3: 88,120,176 L702R probably damaging Het
Itga8 A G 2: 12,265,258 V139A probably damaging Het
Jam2 G A 16: 84,812,952 V151M probably damaging Het
Kbtbd12 T C 6: 88,617,790 I353V probably benign Het
Kif27 T C 13: 58,323,916 E786G probably damaging Het
Lingo4 T A 3: 94,403,365 S537T probably benign Het
Lipo3 C T 19: 33,620,960 probably benign Het
Lrrc3 G T 10: 77,894,032 probably benign Het
Ltbp3 T A 19: 5,748,786 probably null Het
Lyg1 T A 1: 37,946,861 probably benign Het
Mcm9 T C 10: 53,548,527 I656V probably benign Het
Mfsd8 T A 3: 40,821,937 I427F probably benign Het
Mga T A 2: 119,938,623 probably benign Het
Miga1 A G 3: 152,287,518 L422P probably damaging Het
Msantd3 A G 4: 48,552,536 I42V probably benign Het
Mybbp1a T C 11: 72,445,712 V510A probably benign Het
Nccrp1 G T 7: 28,546,335 P135T probably damaging Het
Neb T A 2: 52,255,588 M2975L possibly damaging Het
Nfxl1 A T 5: 72,552,668 I171N probably damaging Het
Olfr1419 T C 19: 11,871,048 H56R possibly damaging Het
Olfr525 T C 7: 140,323,412 F238L possibly damaging Het
Olfr536 A T 7: 140,504,020 F146L probably benign Het
Otop1 T G 5: 38,300,024 S376A possibly damaging Het
Pdgfra T C 5: 75,162,271 V10A possibly damaging Het
Pgs1 T C 11: 118,019,677 V538A probably damaging Het
Ppa2 A T 3: 133,326,684 T97S probably damaging Het
Prdm10 G A 9: 31,327,328 C172Y probably damaging Het
Prrc2c G A 1: 162,680,895 P1091L probably damaging Het
Pthlh G A 6: 147,257,298 R55C probably damaging Het
Ptpn9 A T 9: 57,036,498 T105S probably benign Het
Rundc1 T A 11: 101,434,004 V512E possibly damaging Het
Scrib G A 15: 76,065,336 S307L probably damaging Het
Sec23ip A G 7: 128,750,286 S26G probably null Het
Sec61a2 A G 2: 5,873,693 probably benign Het
Sema3c T C 5: 17,672,513 V206A probably damaging Het
Sgk2 C T 2: 162,997,843 H124Y possibly damaging Het
Slc26a6 C T 9: 108,861,341 T592I probably damaging Het
Slc5a11 T C 7: 123,265,263 Y361H probably damaging Het
Smc6 T C 12: 11,274,007 V51A probably damaging Het
Stab1 A T 14: 31,154,915 N817K possibly damaging Het
Swt1 A T 1: 151,407,597 D336E probably benign Het
Taf13 T A 3: 108,572,977 probably benign Het
Tmub2 T C 11: 102,285,019 probably benign Het
Try10 A G 6: 41,357,827 Y229C probably damaging Het
Ttbk1 G T 17: 46,477,788 Y183* probably null Het
Ttc17 A T 2: 94,364,429 I533N possibly damaging Het
Tubb6 C T 18: 67,401,946 P305L probably damaging Het
Tulp3 G A 6: 128,323,054 probably benign Het
Usp9x A G X: 13,123,508 R776G possibly damaging Het
Virma T C 4: 11,513,505 V453A probably damaging Het
Vmn2r103 A T 17: 19,811,815 N617I probably damaging Het
Xirp1 G T 9: 120,016,992 L942M probably damaging Het
Zc3h7b T G 15: 81,792,250 V731G probably benign Het
Zfp534 C T 4: 147,674,718 G498D probably benign Het
Zfp639 T C 3: 32,520,530 Y435H probably damaging Het
Zxdc A G 6: 90,378,838 H443R probably damaging Het
Other mutations in Tnf
AlleleSourceChrCoordTypePredicted EffectPPH Score
Dome UTSW 17 35201674 missense probably damaging 0.99
Panr1 UTSW 17 35200204 missense probably damaging 1.00
R0783:Tnf UTSW 17 35201674 missense probably damaging 0.99
R0815:Tnf UTSW 17 35201144 unclassified probably benign
R0863:Tnf UTSW 17 35201144 unclassified probably benign
R2195:Tnf UTSW 17 35201113 unclassified probably null
R2570:Tnf UTSW 17 35200500 missense probably damaging 0.99
R6670:Tnf UTSW 17 35201824 missense possibly damaging 0.73
R7319:Tnf UTSW 17 35200371 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- GTCACTGTCCCAGCATCTTG -3'
(R):5'- AAAGTCAACCTCCTCTCTGC -3'

Sequencing Primer
(F):5'- TCTGAGCACAGAGTTGGACC -3'
(R):5'- TCTCTGCCGTCAAGAGCC -3'
Posted On2015-10-08