Incidental Mutation 'R4660:Olfr1419'
ID352815
Institutional Source Beutler Lab
Gene Symbol Olfr1419
Ensembl Gene ENSMUSG00000067545
Gene Nameolfactory receptor 1419
SynonymsMOR266-10, GA_x6K02T2RE5P-2222521-2221490
MMRRC Submission 041920-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R4660 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location11868613-11875106 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 11871048 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 56 (H56R)
Ref Sequence ENSEMBL: ENSMUSP00000148848 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087857] [ENSMUST00000213954] [ENSMUST00000217617]
Predicted Effect possibly damaging
Transcript: ENSMUST00000087857
AA Change: H56R

PolyPhen 2 Score 0.636 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000085163
Gene: ENSMUSG00000067545
AA Change: H56R

DomainStartEndE-ValueType
Pfam:7tm_4 31 309 3.8e-55 PFAM
Pfam:7tm_1 41 291 2.8e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213954
AA Change: H56R

PolyPhen 2 Score 0.636 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect possibly damaging
Transcript: ENSMUST00000217617
AA Change: H56R

PolyPhen 2 Score 0.636 (Sensitivity: 0.87; Specificity: 0.91)
Meta Mutation Damage Score 0.0576 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 96% (102/106)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adra1d T C 2: 131,561,142 T343A probably damaging Het
Angptl4 A T 17: 33,777,275 probably benign Het
Antxr2 A T 5: 98,004,054 probably null Het
Ap1b1 T A 11: 5,016,760 V145E probably damaging Het
Armc4 A G 18: 7,211,609 V755A possibly damaging Het
Asns G T 6: 7,678,012 N355K probably benign Het
Asxl3 A G 18: 22,516,477 T508A probably benign Het
B4galt7 T A 13: 55,604,298 V54D possibly damaging Het
Bach2 C T 4: 32,562,777 P415S probably benign Het
Bbs9 G A 9: 22,578,767 R278Q probably benign Het
Blzf1 C T 1: 164,306,493 probably benign Het
Btd A T 14: 31,667,803 T494S probably benign Het
Casp9 C T 4: 141,813,623 T434I probably benign Het
Cavin2 T C 1: 51,301,351 S396P probably benign Het
Ccnk C T 12: 108,202,316 probably benign Het
Cldn8 G A 16: 88,562,408 H210Y probably benign Het
Clip1 G A 5: 123,579,374 T1284I probably damaging Het
Coch T C 12: 51,595,485 V80A probably benign Het
Cttnbp2 A G 6: 18,406,537 S1052P probably benign Het
Cyp2j7 C T 4: 96,195,342 R457K probably benign Het
Dalrd3 T C 9: 108,570,369 S129P probably benign Het
Ddx10 A G 9: 53,236,398 probably null Het
Dnah7b A T 1: 46,289,536 T3143S probably damaging Het
Dynlt1b A G 17: 6,431,880 T10A probably benign Het
Eif2s2 G A 2: 154,888,269 T36I probably benign Het
Fam118b A T 9: 35,235,255 H105Q possibly damaging Het
Galntl5 T A 5: 25,203,379 I250N probably damaging Het
Gm11544 C T 11: 94,845,480 noncoding transcript Het
Gm13084 A G 4: 143,811,865 S179P probably benign Het
Gm13088 T A 4: 143,654,277 Y392F probably benign Het
Gm5709 C T 3: 59,618,703 noncoding transcript Het
Golgb1 T A 16: 36,887,618 I107N probably damaging Het
Gpld1 T C 13: 24,982,603 probably null Het
Grik1 T A 16: 87,923,131 T768S probably damaging Het
H2-T23 T G 17: 36,030,216 Q349P probably damaging Het
Ing3 A T 6: 21,973,711 probably benign Het
Iqgap3 T G 3: 88,120,176 L702R probably damaging Het
Itga8 A G 2: 12,265,258 V139A probably damaging Het
Jam2 G A 16: 84,812,952 V151M probably damaging Het
Kbtbd12 T C 6: 88,617,790 I353V probably benign Het
Kif27 T C 13: 58,323,916 E786G probably damaging Het
Lingo4 T A 3: 94,403,365 S537T probably benign Het
Lipo3 C T 19: 33,620,960 probably benign Het
Lrrc3 G T 10: 77,894,032 probably benign Het
Ltbp3 T A 19: 5,748,786 probably null Het
Lyg1 T A 1: 37,946,861 probably benign Het
Mcm9 T C 10: 53,548,527 I656V probably benign Het
Mfsd8 T A 3: 40,821,937 I427F probably benign Het
Mga T A 2: 119,938,623 probably benign Het
Miga1 A G 3: 152,287,518 L422P probably damaging Het
Msantd3 A G 4: 48,552,536 I42V probably benign Het
Mybbp1a T C 11: 72,445,712 V510A probably benign Het
Nccrp1 G T 7: 28,546,335 P135T probably damaging Het
Neb T A 2: 52,255,588 M2975L possibly damaging Het
Nfxl1 A T 5: 72,552,668 I171N probably damaging Het
Olfr525 T C 7: 140,323,412 F238L possibly damaging Het
Olfr536 A T 7: 140,504,020 F146L probably benign Het
Otop1 T G 5: 38,300,024 S376A possibly damaging Het
Pdgfra T C 5: 75,162,271 V10A possibly damaging Het
Pgs1 T C 11: 118,019,677 V538A probably damaging Het
Ppa2 A T 3: 133,326,684 T97S probably damaging Het
Prdm10 G A 9: 31,327,328 C172Y probably damaging Het
Prrc2c G A 1: 162,680,895 P1091L probably damaging Het
Pthlh G A 6: 147,257,298 R55C probably damaging Het
Ptpn9 A T 9: 57,036,498 T105S probably benign Het
Rundc1 T A 11: 101,434,004 V512E possibly damaging Het
Scrib G A 15: 76,065,336 S307L probably damaging Het
Sec23ip A G 7: 128,750,286 S26G probably null Het
Sec61a2 A G 2: 5,873,693 probably benign Het
Sema3c T C 5: 17,672,513 V206A probably damaging Het
Sgk2 C T 2: 162,997,843 H124Y possibly damaging Het
Slc26a6 C T 9: 108,861,341 T592I probably damaging Het
Slc5a11 T C 7: 123,265,263 Y361H probably damaging Het
Smc6 T C 12: 11,274,007 V51A probably damaging Het
Stab1 A T 14: 31,154,915 N817K possibly damaging Het
Swt1 A T 1: 151,407,597 D336E probably benign Het
Taf13 T A 3: 108,572,977 probably benign Het
Tmub2 T C 11: 102,285,019 probably benign Het
Tnf A G 17: 35,200,180 S209P probably benign Het
Try10 A G 6: 41,357,827 Y229C probably damaging Het
Ttbk1 G T 17: 46,477,788 Y183* probably null Het
Ttc17 A T 2: 94,364,429 I533N possibly damaging Het
Tubb6 C T 18: 67,401,946 P305L probably damaging Het
Tulp3 G A 6: 128,323,054 probably benign Het
Usp9x A G X: 13,123,508 R776G possibly damaging Het
Virma T C 4: 11,513,505 V453A probably damaging Het
Vmn2r103 A T 17: 19,811,815 N617I probably damaging Het
Xirp1 G T 9: 120,016,992 L942M probably damaging Het
Zc3h7b T G 15: 81,792,250 V731G probably benign Het
Zfp534 C T 4: 147,674,718 G498D probably benign Het
Zfp639 T C 3: 32,520,530 Y435H probably damaging Het
Zxdc A G 6: 90,378,838 H443R probably damaging Het
Other mutations in Olfr1419
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01845:Olfr1419 APN 19 11870524 missense probably benign 0.05
IGL01979:Olfr1419 APN 19 11871223 splice site probably benign
IGL02961:Olfr1419 APN 19 11870331 missense probably damaging 1.00
R0285:Olfr1419 UTSW 19 11871138 missense probably damaging 0.97
R0347:Olfr1419 UTSW 19 11870433 missense probably damaging 1.00
R1577:Olfr1419 UTSW 19 11870377 missense probably damaging 1.00
R2391:Olfr1419 UTSW 19 11870816 nonsense probably null
R3977:Olfr1419 UTSW 19 11870505 missense possibly damaging 0.82
R5201:Olfr1419 UTSW 19 11870631 missense probably benign 0.21
R5995:Olfr1419 UTSW 19 11870862 missense possibly damaging 0.89
R6393:Olfr1419 UTSW 19 11870727 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGATGGCCACATACCTGTC -3'
(R):5'- CCTTGTACTAGGTCTGATGGAG -3'

Sequencing Primer
(F):5'- GATGGCCACATACCTGTCATAGG -3'
(R):5'- CTAGGTCTGATGGAGGAGGAAAATC -3'
Posted On2015-10-08