Incidental Mutation 'R4662:Nr5a2'
ID352908
Institutional Source Beutler Lab
Gene Symbol Nr5a2
Ensembl Gene ENSMUSG00000026398
Gene Namenuclear receptor subfamily 5, group A, member 2
SynonymsD1Ertd308e, Ftf, LRH-1, UF2-H3B
MMRRC Submission 042011-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4662 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location136842571-136960448 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 136940429 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 322 (I322V)
Ref Sequence ENSEMBL: ENSMUSP00000129071 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027649] [ENSMUST00000168126] [ENSMUST00000192357] [ENSMUST00000192929] [ENSMUST00000195428]
Predicted Effect probably benign
Transcript: ENSMUST00000027649
AA Change: I383V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000027649
Gene: ENSMUSG00000026398
AA Change: I383V

DomainStartEndE-ValueType
ZnF_C4 104 175 2.85e-40 SMART
Blast:HOLI 196 247 1e-5 BLAST
low complexity region 290 302 N/A INTRINSIC
HOLI 366 529 4.13e-46 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168126
AA Change: I322V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000129071
Gene: ENSMUSG00000026398
AA Change: I322V

DomainStartEndE-ValueType
ZnF_C4 43 114 2.85e-40 SMART
low complexity region 229 241 N/A INTRINSIC
HOLI 305 468 4.13e-46 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192357
AA Change: I362V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000142219
Gene: ENSMUSG00000026398
AA Change: I362V

DomainStartEndE-ValueType
ZnF_C4 83 154 1.1e-42 SMART
Blast:HOLI 175 226 1e-5 BLAST
low complexity region 269 281 N/A INTRINSIC
HOLI 345 508 1.7e-48 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192587
Predicted Effect probably benign
Transcript: ENSMUST00000192929
AA Change: I322V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000141495
Gene: ENSMUSG00000026398
AA Change: I322V

DomainStartEndE-ValueType
ZnF_C4 43 114 2.85e-40 SMART
low complexity region 229 241 N/A INTRINSIC
HOLI 305 468 4.13e-46 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000195428
SMART Domains Protein: ENSMUSP00000141645
Gene: ENSMUSG00000026398

DomainStartEndE-ValueType
ZnF_C4 43 114 1.1e-42 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a DNA-binding zinc finger transcription factor and is a member of the fushi tarazu factor-1 subfamily of orphan nuclear receptors. The encoded protein is involved in the expression of genes for hepatitis B virus and cholesterol biosynthesis, and may be an important regulator of embryonic development. [provided by RefSeq, Jun 2016]
PHENOTYPE: Mice homozygous for disruptions in this gene die around embryonic day 7.5. Heterozygotes are essentially normal but with lower plasma cholesterol, increased bile acids, and shorter intestinal crypt length. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik A T 6: 91,914,958 Q67L probably benign Het
8030462N17Rik T A 18: 77,674,490 Q42L probably benign Het
Adrb1 A G 19: 56,722,774 T135A probably damaging Het
Asxl2 G T 12: 3,427,193 W13L probably damaging Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Brsk1 T C 7: 4,707,299 S436P possibly damaging Het
Calb2 A G 8: 110,168,077 F21L probably benign Het
Camk2a T C 18: 60,941,339 Y39H probably damaging Het
Cavin2 T C 1: 51,301,351 S396P probably benign Het
Cfdp1 A G 8: 111,830,945 F188S probably benign Het
Chek2 T A 5: 110,867,042 V459D probably damaging Het
Cldn8 G A 16: 88,562,408 H210Y probably benign Het
Cobl A G 11: 12,253,672 V1003A probably benign Het
Ctsll3 A G 13: 60,799,602 F257L possibly damaging Het
Dnajc13 A C 9: 104,207,758 F819V probably damaging Het
Dram1 C A 10: 88,325,384 V208L probably damaging Het
Dynlt1b A G 17: 6,431,880 T10A probably benign Het
Eml6 A T 11: 29,777,390 V1244E probably damaging Het
Ethe1 G A 7: 24,593,980 S17N probably benign Het
Foxi1 T C 11: 34,207,578 D149G probably damaging Het
Fzd9 T C 5: 135,249,621 E470G probably damaging Het
Ggnbp2 A G 11: 84,862,246 F56L probably damaging Het
Gm5346 T A 8: 43,627,079 Y36F probably benign Het
Hao1 G A 2: 134,523,027 R227* probably null Het
Hyal1 G A 9: 107,579,221 R369H probably damaging Het
Jam2 G A 16: 84,812,952 V151M probably damaging Het
Kcna2 T A 3: 107,105,417 I438N probably benign Het
Lrp1 A T 10: 127,552,185 C3331* probably null Het
Mcm9 T C 10: 53,548,527 I656V probably benign Het
Mroh9 C T 1: 163,055,593 C439Y probably damaging Het
N4bp2l2 T C 5: 150,650,695 D85G probably damaging Het
Nr1h2 A G 7: 44,550,431 Y355H probably damaging Het
Nup153 A C 13: 46,687,274 L273V possibly damaging Het
Obscn A G 11: 58,999,596 L7370P unknown Het
Olfr1270 T A 2: 90,149,878 I43F probably damaging Het
Olfr178 A G 16: 58,889,924 C99R probably damaging Het
Olfr403 T C 11: 74,195,716 I71T probably damaging Het
Prkdc G A 16: 15,734,052 D2041N probably damaging Het
Ptdss1 A G 13: 66,933,611 D35G possibly damaging Het
Ptprs G T 17: 56,417,666 T1118K probably damaging Het
Pygb C T 2: 150,815,116 T329I probably benign Het
Rhoh T A 5: 65,892,814 D142E probably benign Het
Saraf C A 8: 34,168,462 A306E probably damaging Het
Scn1a T C 2: 66,350,988 I64V probably benign Het
Sec16a A G 2: 26,430,570 W1333R probably damaging Het
Shroom1 A T 11: 53,466,462 T651S possibly damaging Het
Skint3 C A 4: 112,277,666 Y345* probably null Het
Slc1a7 T A 4: 108,007,554 N263K probably damaging Het
Sptbn2 C T 19: 4,739,239 R1236C probably damaging Het
Tbx21 T C 11: 97,101,567 N226S probably benign Het
Tcrg-V1 T A 13: 19,340,333 L76I possibly damaging Het
Thada A G 17: 84,435,650 L782P probably damaging Het
Tle1 T G 4: 72,137,098 I446L possibly damaging Het
Triobp A G 15: 78,993,269 D1621G probably damaging Het
Trpm2 G C 10: 77,938,138 A481G probably benign Het
Unc80 A T 1: 66,646,436 M2240L probably benign Het
Usp9x A G X: 13,123,508 R776G possibly damaging Homo
Vangl1 T C 3: 102,166,922 T290A probably benign Het
Vmn1r233 T A 17: 20,994,131 I186F probably benign Het
Vmn2r102 G A 17: 19,681,162 C517Y probably damaging Het
Vrk2 G A 11: 26,471,611 T449M possibly damaging Het
Zfp518a A G 19: 40,911,860 S78G probably benign Het
Zscan25 T C 5: 145,286,310 S131P unknown Het
Zscan29 G A 2: 121,166,615 T140I probably benign Het
Other mutations in Nr5a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00799:Nr5a2 APN 1 136890798 missense probably damaging 1.00
IGL01082:Nr5a2 APN 1 136845468 missense probably benign 0.06
IGL02547:Nr5a2 APN 1 136940927 missense probably benign 0.01
IGL02688:Nr5a2 APN 1 136940407 critical splice donor site probably null
IGL02712:Nr5a2 APN 1 136940528 unclassified probably null
R0356:Nr5a2 UTSW 1 136845692 missense possibly damaging 0.91
R0653:Nr5a2 UTSW 1 136948805 missense probably benign 0.04
R1111:Nr5a2 UTSW 1 136882421 splice site probably null
R1728:Nr5a2 UTSW 1 136952125 missense probably benign
R1729:Nr5a2 UTSW 1 136952125 missense probably benign
R1730:Nr5a2 UTSW 1 136952125 missense probably benign
R1739:Nr5a2 UTSW 1 136952125 missense probably benign
R1762:Nr5a2 UTSW 1 136952125 missense probably benign
R1783:Nr5a2 UTSW 1 136952125 missense probably benign
R1784:Nr5a2 UTSW 1 136952125 missense probably benign
R1785:Nr5a2 UTSW 1 136952125 missense probably benign
R1927:Nr5a2 UTSW 1 136944994 missense probably damaging 1.00
R2360:Nr5a2 UTSW 1 136948827 missense probably benign
R3408:Nr5a2 UTSW 1 136940498 missense probably benign
R4861:Nr5a2 UTSW 1 136948720 critical splice donor site probably null
R4861:Nr5a2 UTSW 1 136948720 critical splice donor site probably null
R5176:Nr5a2 UTSW 1 136948802 start codon destroyed probably null 0.96
R5999:Nr5a2 UTSW 1 136845542 missense probably damaging 1.00
R6191:Nr5a2 UTSW 1 136890798 missense probably damaging 1.00
R6457:Nr5a2 UTSW 1 136960238 missense probably benign 0.00
R6747:Nr5a2 UTSW 1 136882344 missense possibly damaging 0.78
X0012:Nr5a2 UTSW 1 136943292 missense probably damaging 1.00
X0065:Nr5a2 UTSW 1 136940777 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGGATGGTCACACACCCATTTC -3'
(R):5'- GCATCCCACACCTGATACTG -3'

Sequencing Primer
(F):5'- GGTCACACACCCATTTCTTCTTTAAC -3'
(R):5'- CTGGAACTTTTGAAGTGTGAACCAG -3'
Posted On2015-10-08