Incidental Mutation 'R4662:Kcna2'
ID352919
Institutional Source Beutler Lab
Gene Symbol Kcna2
Ensembl Gene ENSMUSG00000040724
Gene Namepotassium voltage-gated channel, shaker-related subfamily, member 2
SynonymsMk-2, Akr6a4, Kca1-2, Kv1.2
MMRRC Submission 042011-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4662 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location107101146-107115005 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 107105417 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 438 (I438N)
Ref Sequence ENSEMBL: ENSMUSP00000143798 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038695] [ENSMUST00000196403] [ENSMUST00000197470]
Predicted Effect probably benign
Transcript: ENSMUST00000038695
AA Change: I438N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000041702
Gene: ENSMUSG00000040724
AA Change: I438N

DomainStartEndE-ValueType
BTB 33 133 1.2e-9 SMART
Pfam:Ion_trans 162 421 6.2e-53 PFAM
Pfam:Ion_trans_2 329 414 4.9e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196403
AA Change: I438N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000142873
Gene: ENSMUSG00000040724
AA Change: I438N

DomainStartEndE-ValueType
BTB 33 133 1.2e-9 SMART
low complexity region 164 179 N/A INTRINSIC
Pfam:Ion_trans 224 409 1.3e-36 PFAM
Pfam:Ion_trans_2 329 414 7.9e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197470
AA Change: I438N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000143798
Gene: ENSMUSG00000040724
AA Change: I438N

DomainStartEndE-ValueType
BTB 33 133 1.2e-9 SMART
Pfam:Ion_trans 162 421 6.2e-53 PFAM
Pfam:Ion_trans_2 329 414 4.9e-16 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shaker-related subfamily. This member contains six membrane-spanning domains with a shaker-type repeat in the fourth segment. It belongs to the delayed rectifier class, members of which allow nerve cells to efficiently repolarize following an action potential. The coding region of this gene is intronless, and the gene is clustered with genes KCNA3 and KCNA10 on chromosome 1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit postnatal lethality, increased susceptibility to spontaneous and chemically-induced seizures and altered neuron electrophysiology. Mice homozygous for an ENU-induced allele exhibit abnormal gait, impaired coordination, and premature lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik A T 6: 91,914,958 Q67L probably benign Het
8030462N17Rik T A 18: 77,674,490 Q42L probably benign Het
Adrb1 A G 19: 56,722,774 T135A probably damaging Het
Asxl2 G T 12: 3,427,193 W13L probably damaging Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Brsk1 T C 7: 4,707,299 S436P possibly damaging Het
Calb2 A G 8: 110,168,077 F21L probably benign Het
Camk2a T C 18: 60,941,339 Y39H probably damaging Het
Cavin2 T C 1: 51,301,351 S396P probably benign Het
Cfdp1 A G 8: 111,830,945 F188S probably benign Het
Chek2 T A 5: 110,867,042 V459D probably damaging Het
Cldn8 G A 16: 88,562,408 H210Y probably benign Het
Cobl A G 11: 12,253,672 V1003A probably benign Het
Ctsll3 A G 13: 60,799,602 F257L possibly damaging Het
Dnajc13 A C 9: 104,207,758 F819V probably damaging Het
Dram1 C A 10: 88,325,384 V208L probably damaging Het
Dynlt1b A G 17: 6,431,880 T10A probably benign Het
Eml6 A T 11: 29,777,390 V1244E probably damaging Het
Ethe1 G A 7: 24,593,980 S17N probably benign Het
Foxi1 T C 11: 34,207,578 D149G probably damaging Het
Fzd9 T C 5: 135,249,621 E470G probably damaging Het
Ggnbp2 A G 11: 84,862,246 F56L probably damaging Het
Gm5346 T A 8: 43,627,079 Y36F probably benign Het
Hao1 G A 2: 134,523,027 R227* probably null Het
Hyal1 G A 9: 107,579,221 R369H probably damaging Het
Jam2 G A 16: 84,812,952 V151M probably damaging Het
Lrp1 A T 10: 127,552,185 C3331* probably null Het
Mcm9 T C 10: 53,548,527 I656V probably benign Het
Mroh9 C T 1: 163,055,593 C439Y probably damaging Het
N4bp2l2 T C 5: 150,650,695 D85G probably damaging Het
Nr1h2 A G 7: 44,550,431 Y355H probably damaging Het
Nr5a2 T C 1: 136,940,429 I322V probably benign Het
Nup153 A C 13: 46,687,274 L273V possibly damaging Het
Obscn A G 11: 58,999,596 L7370P unknown Het
Olfr1270 T A 2: 90,149,878 I43F probably damaging Het
Olfr178 A G 16: 58,889,924 C99R probably damaging Het
Olfr403 T C 11: 74,195,716 I71T probably damaging Het
Prkdc G A 16: 15,734,052 D2041N probably damaging Het
Ptdss1 A G 13: 66,933,611 D35G possibly damaging Het
Ptprs G T 17: 56,417,666 T1118K probably damaging Het
Pygb C T 2: 150,815,116 T329I probably benign Het
Rhoh T A 5: 65,892,814 D142E probably benign Het
Saraf C A 8: 34,168,462 A306E probably damaging Het
Scn1a T C 2: 66,350,988 I64V probably benign Het
Sec16a A G 2: 26,430,570 W1333R probably damaging Het
Shroom1 A T 11: 53,466,462 T651S possibly damaging Het
Skint3 C A 4: 112,277,666 Y345* probably null Het
Slc1a7 T A 4: 108,007,554 N263K probably damaging Het
Sptbn2 C T 19: 4,739,239 R1236C probably damaging Het
Tbx21 T C 11: 97,101,567 N226S probably benign Het
Tcrg-V1 T A 13: 19,340,333 L76I possibly damaging Het
Thada A G 17: 84,435,650 L782P probably damaging Het
Tle1 T G 4: 72,137,098 I446L possibly damaging Het
Triobp A G 15: 78,993,269 D1621G probably damaging Het
Trpm2 G C 10: 77,938,138 A481G probably benign Het
Unc80 A T 1: 66,646,436 M2240L probably benign Het
Usp9x A G X: 13,123,508 R776G possibly damaging Homo
Vangl1 T C 3: 102,166,922 T290A probably benign Het
Vmn1r233 T A 17: 20,994,131 I186F probably benign Het
Vmn2r102 G A 17: 19,681,162 C517Y probably damaging Het
Vrk2 G A 11: 26,471,611 T449M possibly damaging Het
Zfp518a A G 19: 40,911,860 S78G probably benign Het
Zscan25 T C 5: 145,286,310 S131P unknown Het
Zscan29 G A 2: 121,166,615 T140I probably benign Het
Other mutations in Kcna2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:Kcna2 APN 3 107104630 missense probably damaging 1.00
IGL00711:Kcna2 APN 3 107104753 missense probably benign
IGL02380:Kcna2 APN 3 107104958 missense probably benign 0.00
grim UTSW 3 107105027 missense probably damaging 1.00
IGL03097:Kcna2 UTSW 3 107105399 missense probably benign 0.02
R0117:Kcna2 UTSW 3 107105354 missense probably damaging 1.00
R0200:Kcna2 UTSW 3 107105160 missense probably benign
R0463:Kcna2 UTSW 3 107105160 missense probably benign
R0472:Kcna2 UTSW 3 107105516 missense probably benign
R0662:Kcna2 UTSW 3 107105401 missense probably benign
R0746:Kcna2 UTSW 3 107105168 missense probably benign
R1838:Kcna2 UTSW 3 107104512 missense probably benign
R1847:Kcna2 UTSW 3 107105113 missense possibly damaging 0.54
R1912:Kcna2 UTSW 3 107105401 missense probably benign
R1966:Kcna2 UTSW 3 107104630 missense probably damaging 1.00
R1971:Kcna2 UTSW 3 107104824 missense probably damaging 1.00
R2419:Kcna2 UTSW 3 107104153 missense probably benign 0.21
R3796:Kcna2 UTSW 3 107105590 missense probably benign 0.37
R3830:Kcna2 UTSW 3 107104796 missense probably benign 0.04
R4273:Kcna2 UTSW 3 107105193 missense probably benign 0.00
R4570:Kcna2 UTSW 3 107104795 missense probably benign
R4756:Kcna2 UTSW 3 107105417 missense probably benign
R5054:Kcna2 UTSW 3 107104340 missense probably damaging 1.00
R5069:Kcna2 UTSW 3 107104637 missense probably damaging 1.00
R5070:Kcna2 UTSW 3 107104637 missense probably damaging 1.00
R5126:Kcna2 UTSW 3 107104234 missense probably damaging 1.00
R5146:Kcna2 UTSW 3 107105498 missense probably benign 0.00
R5205:Kcna2 UTSW 3 107097146 unclassified probably benign
R5472:Kcna2 UTSW 3 107105309 missense possibly damaging 0.93
R6687:Kcna2 UTSW 3 107105027 missense probably damaging 1.00
R6689:Kcna2 UTSW 3 107105027 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGAGACATGGTTCCAACTACC -3'
(R):5'- TTGAGCTGTGAGTACATTAGTAGGC -3'

Sequencing Primer
(F):5'- CAGTCCCTGTCATAGTGT -3'
(R):5'- AGTAGGCTTCAATCAGACATCAG -3'
Posted On2015-10-08