Incidental Mutation 'R4662:Hyal1'
ID352937
Institutional Source Beutler Lab
Gene Symbol Hyal1
Ensembl Gene ENSMUSG00000010051
Gene Namehyaluronoglucosaminidase 1
SynonymsHyal-1
MMRRC Submission 042011-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock #R4662 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location107576927-107581710 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 107579221 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 369 (R369H)
Ref Sequence ENSEMBL: ENSMUSP00000120599 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010195] [ENSMUST00000040059] [ENSMUST00000093785] [ENSMUST00000112387] [ENSMUST00000122985] [ENSMUST00000123005] [ENSMUST00000127380] [ENSMUST00000130053] [ENSMUST00000139274] [ENSMUST00000139581] [ENSMUST00000144392] [ENSMUST00000148440] [ENSMUST00000149638]
Predicted Effect probably damaging
Transcript: ENSMUST00000010195
AA Change: R399H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000010195
Gene: ENSMUSG00000010051
AA Change: R399H

DomainStartEndE-ValueType
low complexity region 33 46 N/A INTRINSIC
Pfam:Glyco_hydro_56 53 383 5.7e-134 PFAM
EGF 385 458 1.4e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000040059
SMART Domains Protein: ENSMUSP00000042667
Gene: ENSMUSG00000036091

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Glyco_hydro_56 25 354 4.8e-122 PFAM
EGF 356 408 2.9e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000093785
SMART Domains Protein: ENSMUSP00000091300
Gene: ENSMUSG00000079334

DomainStartEndE-ValueType
internal_repeat_1 2 41 4.95e-7 PROSPERO
internal_repeat_1 40 99 4.95e-7 PROSPERO
Pfam:Acetyltransf_1 144 217 2.1e-12 PFAM
Pfam:Acetyltransf_7 147 218 9.5e-9 PFAM
low complexity region 242 253 N/A INTRINSIC
low complexity region 261 296 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112387
AA Change: R399H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108006
Gene: ENSMUSG00000010051
AA Change: R399H

DomainStartEndE-ValueType
low complexity region 33 46 N/A INTRINSIC
Pfam:Glyco_hydro_56 50 384 7e-153 PFAM
Blast:EGF 385 454 1e-42 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000122985
SMART Domains Protein: ENSMUSP00000122807
Gene: ENSMUSG00000079334

DomainStartEndE-ValueType
internal_repeat_1 2 41 2.46e-5 PROSPERO
internal_repeat_1 40 99 2.46e-5 PROSPERO
Pfam:Acetyltransf_1 144 204 3.3e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000123005
AA Change: R119H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122601
Gene: ENSMUSG00000010051
AA Change: R119H

DomainStartEndE-ValueType
Pfam:Glyco_hydro_56 1 104 6.8e-37 PFAM
EGF 105 178 1.4e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127380
SMART Domains Protein: ENSMUSP00000116378
Gene: ENSMUSG00000079334

DomainStartEndE-ValueType
internal_repeat_1 2 41 2.46e-5 PROSPERO
internal_repeat_1 40 99 2.46e-5 PROSPERO
Pfam:Acetyltransf_1 144 204 3.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130053
SMART Domains Protein: ENSMUSP00000114490
Gene: ENSMUSG00000079334

DomainStartEndE-ValueType
internal_repeat_1 2 41 2.46e-5 PROSPERO
internal_repeat_1 40 99 2.46e-5 PROSPERO
Pfam:Acetyltransf_1 144 204 3.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139274
SMART Domains Protein: ENSMUSP00000138933
Gene: ENSMUSG00000079334

DomainStartEndE-ValueType
Pfam:Acetyltransf_1 45 105 7.4e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139581
SMART Domains Protein: ENSMUSP00000122321
Gene: ENSMUSG00000079334

DomainStartEndE-ValueType
internal_repeat_1 2 41 2.46e-5 PROSPERO
internal_repeat_1 40 99 2.46e-5 PROSPERO
Pfam:Acetyltransf_1 144 204 3.3e-12 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000144392
AA Change: R369H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120599
Gene: ENSMUSG00000010051
AA Change: R369H

DomainStartEndE-ValueType
low complexity region 33 46 N/A INTRINSIC
Pfam:Glyco_hydro_56 50 330 1.8e-128 PFAM
Pfam:Glyco_hydro_56 325 354 2.6e-8 PFAM
EGF 355 428 1.4e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148440
SMART Domains Protein: ENSMUSP00000119499
Gene: ENSMUSG00000036091

DomainStartEndE-ValueType
Pfam:Glyco_hydro_56 21 355 2.6e-127 PFAM
EGF 356 408 2.9e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149638
SMART Domains Protein: ENSMUSP00000139004
Gene: ENSMUSG00000079334

DomainStartEndE-ValueType
Pfam:Acetyltransf_1 45 105 7.4e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162027
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184695
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a lysosomal hyaluronidase. Hyaluronidases intracellularly degrade hyaluronan, one of the major glycosaminoglycans of the extracellular matrix. Hyaluronan is thought to be involved in cell proliferation, migration and differentiation. This enzyme is active at an acidic pH and is the major hyaluronidase in plasma. Mutations in this gene are associated with mucopolysaccharidosis type IX, or hyaluronidase deficiency. The gene is one of several related genes in a region of chromosome 3p21.3 associated with tumor suppression. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display a progressive osteoarthritis associated with bony outgrowths, early loss of articular cartilage proteoglycans and accumulation of hyaluronan (HA) in the cartilage of knee joints, but show no signs of non-skeletal tissue GAG accumulation or increased serum HA levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik A T 6: 91,914,958 Q67L probably benign Het
8030462N17Rik T A 18: 77,674,490 Q42L probably benign Het
Adrb1 A G 19: 56,722,774 T135A probably damaging Het
Asxl2 G T 12: 3,427,193 W13L probably damaging Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Brsk1 T C 7: 4,707,299 S436P possibly damaging Het
Calb2 A G 8: 110,168,077 F21L probably benign Het
Camk2a T C 18: 60,941,339 Y39H probably damaging Het
Cavin2 T C 1: 51,301,351 S396P probably benign Het
Cfdp1 A G 8: 111,830,945 F188S probably benign Het
Chek2 T A 5: 110,867,042 V459D probably damaging Het
Cldn8 G A 16: 88,562,408 H210Y probably benign Het
Cobl A G 11: 12,253,672 V1003A probably benign Het
Ctsll3 A G 13: 60,799,602 F257L possibly damaging Het
Dnajc13 A C 9: 104,207,758 F819V probably damaging Het
Dram1 C A 10: 88,325,384 V208L probably damaging Het
Dynlt1b A G 17: 6,431,880 T10A probably benign Het
Eml6 A T 11: 29,777,390 V1244E probably damaging Het
Ethe1 G A 7: 24,593,980 S17N probably benign Het
Foxi1 T C 11: 34,207,578 D149G probably damaging Het
Fzd9 T C 5: 135,249,621 E470G probably damaging Het
Ggnbp2 A G 11: 84,862,246 F56L probably damaging Het
Gm5346 T A 8: 43,627,079 Y36F probably benign Het
Hao1 G A 2: 134,523,027 R227* probably null Het
Jam2 G A 16: 84,812,952 V151M probably damaging Het
Kcna2 T A 3: 107,105,417 I438N probably benign Het
Lrp1 A T 10: 127,552,185 C3331* probably null Het
Mcm9 T C 10: 53,548,527 I656V probably benign Het
Mroh9 C T 1: 163,055,593 C439Y probably damaging Het
N4bp2l2 T C 5: 150,650,695 D85G probably damaging Het
Nr1h2 A G 7: 44,550,431 Y355H probably damaging Het
Nr5a2 T C 1: 136,940,429 I322V probably benign Het
Nup153 A C 13: 46,687,274 L273V possibly damaging Het
Obscn A G 11: 58,999,596 L7370P unknown Het
Olfr1270 T A 2: 90,149,878 I43F probably damaging Het
Olfr178 A G 16: 58,889,924 C99R probably damaging Het
Olfr403 T C 11: 74,195,716 I71T probably damaging Het
Prkdc G A 16: 15,734,052 D2041N probably damaging Het
Ptdss1 A G 13: 66,933,611 D35G possibly damaging Het
Ptprs G T 17: 56,417,666 T1118K probably damaging Het
Pygb C T 2: 150,815,116 T329I probably benign Het
Rhoh T A 5: 65,892,814 D142E probably benign Het
Saraf C A 8: 34,168,462 A306E probably damaging Het
Scn1a T C 2: 66,350,988 I64V probably benign Het
Sec16a A G 2: 26,430,570 W1333R probably damaging Het
Shroom1 A T 11: 53,466,462 T651S possibly damaging Het
Skint3 C A 4: 112,277,666 Y345* probably null Het
Slc1a7 T A 4: 108,007,554 N263K probably damaging Het
Sptbn2 C T 19: 4,739,239 R1236C probably damaging Het
Tbx21 T C 11: 97,101,567 N226S probably benign Het
Tcrg-V1 T A 13: 19,340,333 L76I possibly damaging Het
Thada A G 17: 84,435,650 L782P probably damaging Het
Tle1 T G 4: 72,137,098 I446L possibly damaging Het
Triobp A G 15: 78,993,269 D1621G probably damaging Het
Trpm2 G C 10: 77,938,138 A481G probably benign Het
Unc80 A T 1: 66,646,436 M2240L probably benign Het
Usp9x A G X: 13,123,508 R776G possibly damaging Homo
Vangl1 T C 3: 102,166,922 T290A probably benign Het
Vmn1r233 T A 17: 20,994,131 I186F probably benign Het
Vmn2r102 G A 17: 19,681,162 C517Y probably damaging Het
Vrk2 G A 11: 26,471,611 T449M possibly damaging Het
Zfp518a A G 19: 40,911,860 S78G probably benign Het
Zscan25 T C 5: 145,286,310 S131P unknown Het
Zscan29 G A 2: 121,166,615 T140I probably benign Het
Other mutations in Hyal1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01768:Hyal1 APN 9 107579139 missense probably damaging 1.00
IGL02265:Hyal1 APN 9 107577908 missense probably benign 0.03
R0043:Hyal1 UTSW 9 107579320 missense probably benign 0.15
R0727:Hyal1 UTSW 9 107578402 missense possibly damaging 0.71
R1497:Hyal1 UTSW 9 107577995 unclassified probably null
R1499:Hyal1 UTSW 9 107577892 missense probably damaging 1.00
R3903:Hyal1 UTSW 9 107578972 critical splice donor site probably null
R4977:Hyal1 UTSW 9 107578954 missense probably benign 0.19
R5122:Hyal1 UTSW 9 107578069 missense probably benign 0.00
R5781:Hyal1 UTSW 9 107577667 missense probably damaging 1.00
R6142:Hyal1 UTSW 9 107579374 missense probably benign 0.00
R6651:Hyal1 UTSW 9 107579371 missense probably damaging 1.00
R6945:Hyal1 UTSW 9 107579170 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TCCTGACATCCTGGCTAAGC -3'
(R):5'- GGGTGCAGCTAATCATCACATAC -3'

Sequencing Primer
(F):5'- ATCCTGGCTAAGCACCAGG -3'
(R):5'- GCTAATCATCACATACCCCGCTTG -3'
Posted On2015-10-08