Incidental Mutation 'R4663:Bag2'
ID352973
Institutional Source Beutler Lab
Gene Symbol Bag2
Ensembl Gene ENSMUSG00000042215
Gene NameBCL2-associated athanogene 2
Synonyms2610042A13Rik
MMRRC Submission 041921-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.164) question?
Stock #R4663 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location33745484-33757795 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 33746993 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 83 (T83A)
Ref Sequence ENSEMBL: ENSMUSP00000042009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044691] [ENSMUST00000088287] [ENSMUST00000115174] [ENSMUST00000138024] [ENSMUST00000187602]
PDB Structure
Chaperone Complex [X-RAY DIFFRACTION]
Structure of the BNB domain of the Hsp70 cochaperone Bag2 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000044691
AA Change: T83A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000042009
Gene: ENSMUSG00000042215
AA Change: T83A

DomainStartEndE-ValueType
coiled coil region 20 60 N/A INTRINSIC
BAG 109 189 4.18e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000088287
SMART Domains Protein: ENSMUSP00000085625
Gene: ENSMUSG00000004768

DomainStartEndE-ValueType
RAB 10 172 7.79e-58 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115174
SMART Domains Protein: ENSMUSP00000110828
Gene: ENSMUSG00000004768

DomainStartEndE-ValueType
RAB 10 172 7.79e-58 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138024
SMART Domains Protein: ENSMUSP00000137896
Gene: ENSMUSG00000004768

DomainStartEndE-ValueType
Pfam:Miro 11 59 1.9e-6 PFAM
Pfam:Ras 11 61 6.3e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155484
Predicted Effect unknown
Transcript: ENSMUST00000187602
AA Change: D46G
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195310
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] BAG proteins compete with Hip for binding to the Hsc70/Hsp70 ATPase domain and promote substrate release. All the BAG proteins have an approximately 45-amino acid BAG domain near the C terminus but differ markedly in their N-terminal regions. The predicted BAG2 protein contains 211 amino acids. The BAG domains of BAG1, BAG2, and BAG3 interact specifically with the Hsc70 ATPase domain in vitro and in mammalian cells. All 3 proteins bind with high affinity to the ATPase domain of Hsc70 and inhibit its chaperone activity in a Hip-repressible manner. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,218,455 V1496A probably benign Het
Aqr A T 2: 114,161,666 Y76* probably null Het
Armc5 C A 7: 128,238,545 A140E probably benign Het
Auts2 T C 5: 131,439,638 H947R probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Bean1 A G 8: 104,211,167 Y126C probably damaging Het
Cars T C 7: 143,575,960 E330G probably damaging Het
Ccdc40 A G 11: 119,231,506 I45V probably benign Het
Cd320 G A 17: 33,848,178 G214R probably null Het
Ckm G A 7: 19,419,494 V237M probably damaging Het
Cspg4 T C 9: 56,886,676 V565A possibly damaging Het
Ephb6 A G 6: 41,617,865 Y638C probably damaging Het
Epp13 T G 7: 6,258,625 I35S possibly damaging Het
Fam196a A T 7: 134,899,148 Y409* probably null Het
Fat2 G C 11: 55,296,213 S1269* probably null Het
Fbxo3 T C 2: 104,053,475 V348A probably damaging Het
Gas6 G A 8: 13,470,254 P478L probably damaging Het
Gm11492 T A 11: 87,567,603 Y268N probably damaging Het
Herc1 T C 9: 66,433,378 S1670P probably damaging Het
Hnrnpk C A 13: 58,394,517 R281L probably damaging Het
Ifih1 C A 2: 62,609,219 C488F probably benign Het
Ift172 T C 5: 31,284,215 K192E probably benign Het
Ighv5-9 T A 12: 113,661,820 Q101L probably benign Het
Igkv3-2 G T 6: 70,698,879 M57I probably benign Het
Itpr2 A G 6: 146,373,173 F837S probably damaging Het
L3mbtl3 T C 10: 26,337,817 Y237C unknown Het
Lats1 G A 10: 7,712,583 C988Y probably damaging Het
Lgals3 T A 14: 47,381,622 probably null Het
Lrrc3b G T 14: 15,358,220 H129N probably benign Het
Lrriq1 T C 10: 103,063,412 H1656R possibly damaging Het
Lypd6 T G 2: 50,173,611 Y43* probably null Het
Mfsd7a T C 5: 108,442,145 M464V probably benign Het
Mical2 A G 7: 112,328,677 D674G possibly damaging Het
Msi1 G A 5: 115,450,275 R284Q probably damaging Het
Mybpc2 T C 7: 44,505,642 E947G probably damaging Het
Nat14 T A 7: 4,924,447 L206Q probably damaging Het
Nup88 A T 11: 70,965,846 probably null Het
Olfr27 A T 9: 39,144,849 I250F probably damaging Het
Olfr727 A G 14: 50,127,482 R302G probably benign Het
Olfr743 A T 14: 50,533,604 Y64F probably damaging Het
Pdcl T C 2: 37,355,766 E75G probably damaging Het
Phf14 A G 6: 11,953,422 I387V possibly damaging Het
Phf3 G A 1: 30,821,215 R845W probably damaging Het
Pm20d1 T C 1: 131,798,602 I59T probably damaging Het
Prkd1 C T 12: 50,419,848 probably null Het
Psmb2 T C 4: 126,677,765 L4P probably damaging Het
Pttg1 T A 11: 43,424,850 K46* probably null Het
Rrnad1 A G 3: 87,927,748 S82P probably damaging Het
Ryr2 T C 13: 11,749,509 H1401R possibly damaging Het
Sh3d19 G A 3: 86,123,263 D696N probably benign Het
Slc16a2 T C X: 103,707,979 T274A probably benign Het
Slc26a6 G A 9: 108,857,907 A335T probably damaging Het
Slc6a5 C A 7: 49,938,398 Y493* probably null Het
Slf1 A T 13: 77,126,604 S37R probably damaging Het
Smoc1 G A 12: 81,167,602 G264S probably damaging Het
Snapc4 T C 2: 26,374,181 E280G possibly damaging Het
Snx25 G A 8: 46,035,579 T913M probably damaging Het
Snx7 T C 3: 117,800,879 T408A probably benign Het
Spdya T A 17: 71,578,344 S264R probably benign Het
Spg11 A T 2: 122,098,099 probably null Het
Suz12 T A 11: 80,013,524 L230Q probably damaging Het
Szt2 A G 4: 118,377,684 probably benign Het
Tenm3 C A 8: 48,235,970 R2194L probably damaging Het
Tmed8 T A 12: 87,174,231 I194F probably damaging Het
Tmem79 T A 3: 88,333,444 T66S probably damaging Het
Trappc1 T A 11: 69,325,511 S118T probably benign Het
Ttn C T 2: 76,738,881 V27223I probably benign Het
Ttn T C 2: 76,776,495 T18024A probably damaging Het
Vmn2r15 C T 5: 109,294,074 M164I probably benign Het
Vmn2r53 T A 7: 12,600,974 Y253F probably benign Het
Wdr92 T C 11: 17,232,853 V338A probably benign Het
Zfand6 C T 7: 84,617,885 R163H probably benign Het
Other mutations in Bag2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01635:Bag2 APN 1 33746932 missense possibly damaging 0.86
R0568:Bag2 UTSW 1 33746978 missense probably benign 0.01
R2144:Bag2 UTSW 1 33746831 missense possibly damaging 0.87
R3712:Bag2 UTSW 1 33746916 missense probably benign 0.11
R4745:Bag2 UTSW 1 33748336 splice site probably null
R4828:Bag2 UTSW 1 33746887 missense probably damaging 0.99
R4859:Bag2 UTSW 1 33746941 missense probably damaging 1.00
R4911:Bag2 UTSW 1 33748276 missense probably benign
R5643:Bag2 UTSW 1 33746953 missense probably damaging 0.99
R5644:Bag2 UTSW 1 33746953 missense probably damaging 0.99
R6899:Bag2 UTSW 1 33746831 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TTGAAACTTCTGGTCCACCGG -3'
(R):5'- AACTGTGTGAAGACTTTTCCTCAG -3'

Sequencing Primer
(F):5'- ACCTCCGATGAGCAGGCAC -3'
(R):5'- AGTTATGCTGATATGCCGTAGTAC -3'
Posted On2015-10-08