Incidental Mutation 'R4663:Fbxo3'
ID352984
Institutional Source Beutler Lab
Gene Symbol Fbxo3
Ensembl Gene ENSMUSG00000027180
Gene NameF-box protein 3
SynonymsFba, 1200002G09Rik, 1700026K02Rik
MMRRC Submission 041921-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.304) question?
Stock #R4663 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location104027721-104063240 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104053475 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 348 (V348A)
Ref Sequence ENSEMBL: ENSMUSP00000106766 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028603] [ENSMUST00000102565] [ENSMUST00000111135] [ENSMUST00000111136]
Predicted Effect probably damaging
Transcript: ENSMUST00000028603
AA Change: V348A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028603
Gene: ENSMUSG00000027180
AA Change: V348A

DomainStartEndE-ValueType
FBOX 16 56 2.83e-4 SMART
SMI1_KNR4 121 251 3.02e-5 SMART
Pfam:DUF525 294 384 3.1e-30 PFAM
coiled coil region 417 446 N/A INTRINSIC
low complexity region 462 475 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102565
AA Change: V348A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099625
Gene: ENSMUSG00000027180
AA Change: V348A

DomainStartEndE-ValueType
FBOX 16 56 2.83e-4 SMART
SMI1_KNR4 121 251 3.02e-5 SMART
Pfam:DUF525 293 385 1.8e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111135
AA Change: V343A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106765
Gene: ENSMUSG00000027180
AA Change: V343A

DomainStartEndE-ValueType
SCOP:d1fs1a1 14 48 4e-3 SMART
Blast:FBOX 16 51 2e-13 BLAST
SMI1_KNR4 116 246 3.02e-5 SMART
Pfam:DUF525 288 380 1.7e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111136
AA Change: V348A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106766
Gene: ENSMUSG00000027180
AA Change: V348A

DomainStartEndE-ValueType
FBOX 16 56 2.83e-4 SMART
SMI1_KNR4 121 251 3.02e-5 SMART
Pfam:DUF525 293 361 1.2e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143799
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. Alternative splicing of this gene generates 2 transcript variants diverging at the 3' end. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,218,455 V1496A probably benign Het
Aqr A T 2: 114,161,666 Y76* probably null Het
Armc5 C A 7: 128,238,545 A140E probably benign Het
Auts2 T C 5: 131,439,638 H947R probably damaging Het
Bag2 T C 1: 33,746,993 T83A probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Bean1 A G 8: 104,211,167 Y126C probably damaging Het
Cars T C 7: 143,575,960 E330G probably damaging Het
Ccdc40 A G 11: 119,231,506 I45V probably benign Het
Cd320 G A 17: 33,848,178 G214R probably null Het
Ckm G A 7: 19,419,494 V237M probably damaging Het
Cspg4 T C 9: 56,886,676 V565A possibly damaging Het
Ephb6 A G 6: 41,617,865 Y638C probably damaging Het
Epp13 T G 7: 6,258,625 I35S possibly damaging Het
Fam196a A T 7: 134,899,148 Y409* probably null Het
Fat2 G C 11: 55,296,213 S1269* probably null Het
Gas6 G A 8: 13,470,254 P478L probably damaging Het
Gm11492 T A 11: 87,567,603 Y268N probably damaging Het
Herc1 T C 9: 66,433,378 S1670P probably damaging Het
Hnrnpk C A 13: 58,394,517 R281L probably damaging Het
Ifih1 C A 2: 62,609,219 C488F probably benign Het
Ift172 T C 5: 31,284,215 K192E probably benign Het
Ighv5-9 T A 12: 113,661,820 Q101L probably benign Het
Igkv3-2 G T 6: 70,698,879 M57I probably benign Het
Itpr2 A G 6: 146,373,173 F837S probably damaging Het
L3mbtl3 T C 10: 26,337,817 Y237C unknown Het
Lats1 G A 10: 7,712,583 C988Y probably damaging Het
Lgals3 T A 14: 47,381,622 probably null Het
Lrrc3b G T 14: 15,358,220 H129N probably benign Het
Lrriq1 T C 10: 103,063,412 H1656R possibly damaging Het
Lypd6 T G 2: 50,173,611 Y43* probably null Het
Mfsd7a T C 5: 108,442,145 M464V probably benign Het
Mical2 A G 7: 112,328,677 D674G possibly damaging Het
Msi1 G A 5: 115,450,275 R284Q probably damaging Het
Mybpc2 T C 7: 44,505,642 E947G probably damaging Het
Nat14 T A 7: 4,924,447 L206Q probably damaging Het
Nup88 A T 11: 70,965,846 probably null Het
Olfr27 A T 9: 39,144,849 I250F probably damaging Het
Olfr727 A G 14: 50,127,482 R302G probably benign Het
Olfr743 A T 14: 50,533,604 Y64F probably damaging Het
Pdcl T C 2: 37,355,766 E75G probably damaging Het
Phf14 A G 6: 11,953,422 I387V possibly damaging Het
Phf3 G A 1: 30,821,215 R845W probably damaging Het
Pm20d1 T C 1: 131,798,602 I59T probably damaging Het
Prkd1 C T 12: 50,419,848 probably null Het
Psmb2 T C 4: 126,677,765 L4P probably damaging Het
Pttg1 T A 11: 43,424,850 K46* probably null Het
Rrnad1 A G 3: 87,927,748 S82P probably damaging Het
Ryr2 T C 13: 11,749,509 H1401R possibly damaging Het
Sh3d19 G A 3: 86,123,263 D696N probably benign Het
Slc16a2 T C X: 103,707,979 T274A probably benign Het
Slc26a6 G A 9: 108,857,907 A335T probably damaging Het
Slc6a5 C A 7: 49,938,398 Y493* probably null Het
Slf1 A T 13: 77,126,604 S37R probably damaging Het
Smoc1 G A 12: 81,167,602 G264S probably damaging Het
Snapc4 T C 2: 26,374,181 E280G possibly damaging Het
Snx25 G A 8: 46,035,579 T913M probably damaging Het
Snx7 T C 3: 117,800,879 T408A probably benign Het
Spdya T A 17: 71,578,344 S264R probably benign Het
Spg11 A T 2: 122,098,099 probably null Het
Suz12 T A 11: 80,013,524 L230Q probably damaging Het
Szt2 A G 4: 118,377,684 probably benign Het
Tenm3 C A 8: 48,235,970 R2194L probably damaging Het
Tmed8 T A 12: 87,174,231 I194F probably damaging Het
Tmem79 T A 3: 88,333,444 T66S probably damaging Het
Trappc1 T A 11: 69,325,511 S118T probably benign Het
Ttn C T 2: 76,738,881 V27223I probably benign Het
Ttn T C 2: 76,776,495 T18024A probably damaging Het
Vmn2r15 C T 5: 109,294,074 M164I probably benign Het
Vmn2r53 T A 7: 12,600,974 Y253F probably benign Het
Wdr92 T C 11: 17,232,853 V338A probably benign Het
Zfand6 C T 7: 84,617,885 R163H probably benign Het
Other mutations in Fbxo3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01508:Fbxo3 APN 2 104033676 missense probably benign 0.25
IGL02187:Fbxo3 APN 2 104027950 missense probably damaging 0.99
IGL02323:Fbxo3 APN 2 104047951 missense probably benign 0.38
IGL02941:Fbxo3 APN 2 104050294 missense probably damaging 1.00
IGL03160:Fbxo3 APN 2 104030347 nonsense probably null
IGL03346:Fbxo3 APN 2 104050294 missense probably damaging 1.00
R2163:Fbxo3 UTSW 2 104054985 missense probably benign 0.20
R2899:Fbxo3 UTSW 2 104051135 missense probably damaging 1.00
R4256:Fbxo3 UTSW 2 104051165 missense probably damaging 1.00
R4914:Fbxo3 UTSW 2 104054966 missense probably damaging 1.00
R4915:Fbxo3 UTSW 2 104054966 missense probably damaging 1.00
R4918:Fbxo3 UTSW 2 104054966 missense probably damaging 1.00
R7001:Fbxo3 UTSW 2 104051224 missense probably damaging 1.00
R7223:Fbxo3 UTSW 2 104043012 missense possibly damaging 0.86
R7226:Fbxo3 UTSW 2 104050297 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- AACTTAGGGCTAATGTGGACTTTG -3'
(R):5'- CCCTAGATGATGCACAGAAAGG -3'

Sequencing Primer
(F):5'- AGTATTAATTCAAGCGCTGTAGTAC -3'
(R):5'- TGATGCACAGAAAGGGAAATCC -3'
Posted On2015-10-08