Incidental Mutation 'R4663:Spg11'
ID352986
Institutional Source Beutler Lab
Gene Symbol Spg11
Ensembl Gene ENSMUSG00000033396
Gene NameSPG11, spatacsin vesicle trafficking associated
SynonymsC530005A01Rik, 6030465E24Rik
MMRRC Submission 041921-MU
Accession Numbers

Genbank: NM_145531

Is this an essential gene? Possibly non essential (E-score: 0.471) question?
Stock #R4663 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location122053520-122118386 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 122098099 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000037543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036450]
Predicted Effect probably null
Transcript: ENSMUST00000036450
SMART Domains Protein: ENSMUSP00000037543
Gene: ENSMUSG00000033396

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
low complexity region 254 276 N/A INTRINSIC
low complexity region 945 958 N/A INTRINSIC
low complexity region 1250 1264 N/A INTRINSIC
low complexity region 1305 1313 N/A INTRINSIC
low complexity region 1673 1684 N/A INTRINSIC
low complexity region 1772 1784 N/A INTRINSIC
Pfam:Spatacsin_C 2082 2374 1.1e-105 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133145
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a potential transmembrane protein that is phosphorylated upon DNA damage. Defects in this gene are a cause of spastic paraplegia type 11 (SPG11). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
PHENOTYPE: Mice homozygous for a knock-out allele develop a progressive spastic and ataxic gait disorder and show loss of cortical motoneurons and Purkinje cells, a reduced number of lysosomes available for fusion with autophagosomes in degenerating neurons, and accumulation of autolysosome-derived material. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Gene trapped(10)

Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,218,455 V1496A probably benign Het
Aqr A T 2: 114,161,666 Y76* probably null Het
Armc5 C A 7: 128,238,545 A140E probably benign Het
Auts2 T C 5: 131,439,638 H947R probably damaging Het
Bag2 T C 1: 33,746,993 T83A probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Bean1 A G 8: 104,211,167 Y126C probably damaging Het
Cars T C 7: 143,575,960 E330G probably damaging Het
Ccdc40 A G 11: 119,231,506 I45V probably benign Het
Cd320 G A 17: 33,848,178 G214R probably null Het
Ckm G A 7: 19,419,494 V237M probably damaging Het
Cspg4 T C 9: 56,886,676 V565A possibly damaging Het
Ephb6 A G 6: 41,617,865 Y638C probably damaging Het
Epp13 T G 7: 6,258,625 I35S possibly damaging Het
Fam196a A T 7: 134,899,148 Y409* probably null Het
Fat2 G C 11: 55,296,213 S1269* probably null Het
Fbxo3 T C 2: 104,053,475 V348A probably damaging Het
Gas6 G A 8: 13,470,254 P478L probably damaging Het
Gm11492 T A 11: 87,567,603 Y268N probably damaging Het
Herc1 T C 9: 66,433,378 S1670P probably damaging Het
Hnrnpk C A 13: 58,394,517 R281L probably damaging Het
Ifih1 C A 2: 62,609,219 C488F probably benign Het
Ift172 T C 5: 31,284,215 K192E probably benign Het
Ighv5-9 T A 12: 113,661,820 Q101L probably benign Het
Igkv3-2 G T 6: 70,698,879 M57I probably benign Het
Itpr2 A G 6: 146,373,173 F837S probably damaging Het
L3mbtl3 T C 10: 26,337,817 Y237C unknown Het
Lats1 G A 10: 7,712,583 C988Y probably damaging Het
Lgals3 T A 14: 47,381,622 probably null Het
Lrrc3b G T 14: 15,358,220 H129N probably benign Het
Lrriq1 T C 10: 103,063,412 H1656R possibly damaging Het
Lypd6 T G 2: 50,173,611 Y43* probably null Het
Mfsd7a T C 5: 108,442,145 M464V probably benign Het
Mical2 A G 7: 112,328,677 D674G possibly damaging Het
Msi1 G A 5: 115,450,275 R284Q probably damaging Het
Mybpc2 T C 7: 44,505,642 E947G probably damaging Het
Nat14 T A 7: 4,924,447 L206Q probably damaging Het
Nup88 A T 11: 70,965,846 probably null Het
Olfr27 A T 9: 39,144,849 I250F probably damaging Het
Olfr727 A G 14: 50,127,482 R302G probably benign Het
Olfr743 A T 14: 50,533,604 Y64F probably damaging Het
Pdcl T C 2: 37,355,766 E75G probably damaging Het
Phf14 A G 6: 11,953,422 I387V possibly damaging Het
Phf3 G A 1: 30,821,215 R845W probably damaging Het
Pm20d1 T C 1: 131,798,602 I59T probably damaging Het
Prkd1 C T 12: 50,419,848 probably null Het
Psmb2 T C 4: 126,677,765 L4P probably damaging Het
Pttg1 T A 11: 43,424,850 K46* probably null Het
Rrnad1 A G 3: 87,927,748 S82P probably damaging Het
Ryr2 T C 13: 11,749,509 H1401R possibly damaging Het
Sh3d19 G A 3: 86,123,263 D696N probably benign Het
Slc16a2 T C X: 103,707,979 T274A probably benign Het
Slc26a6 G A 9: 108,857,907 A335T probably damaging Het
Slc6a5 C A 7: 49,938,398 Y493* probably null Het
Slf1 A T 13: 77,126,604 S37R probably damaging Het
Smoc1 G A 12: 81,167,602 G264S probably damaging Het
Snapc4 T C 2: 26,374,181 E280G possibly damaging Het
Snx25 G A 8: 46,035,579 T913M probably damaging Het
Snx7 T C 3: 117,800,879 T408A probably benign Het
Spdya T A 17: 71,578,344 S264R probably benign Het
Suz12 T A 11: 80,013,524 L230Q probably damaging Het
Szt2 A G 4: 118,377,684 probably benign Het
Tenm3 C A 8: 48,235,970 R2194L probably damaging Het
Tmed8 T A 12: 87,174,231 I194F probably damaging Het
Tmem79 T A 3: 88,333,444 T66S probably damaging Het
Trappc1 T A 11: 69,325,511 S118T probably benign Het
Ttn C T 2: 76,738,881 V27223I probably benign Het
Ttn T C 2: 76,776,495 T18024A probably damaging Het
Vmn2r15 C T 5: 109,294,074 M164I probably benign Het
Vmn2r53 T A 7: 12,600,974 Y253F probably benign Het
Wdr92 T C 11: 17,232,853 V338A probably benign Het
Zfand6 C T 7: 84,617,885 R163H probably benign Het
Other mutations in Spg11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:Spg11 APN 2 122065560 missense probably damaging 0.96
IGL00495:Spg11 APN 2 122094456 critical splice donor site probably null
IGL00757:Spg11 APN 2 122070959 missense probably benign 0.05
IGL01304:Spg11 APN 2 122072290 missense probably damaging 1.00
IGL01355:Spg11 APN 2 122113156 missense probably benign
IGL01626:Spg11 APN 2 122060971 missense probably damaging 0.98
IGL01739:Spg11 APN 2 122114671 missense probably damaging 1.00
IGL01835:Spg11 APN 2 122088224 missense probably benign 0.36
IGL02129:Spg11 APN 2 122095686 missense probably damaging 0.99
IGL02178:Spg11 APN 2 122097302 missense probably damaging 1.00
IGL02199:Spg11 APN 2 122059553 missense probably damaging 1.00
IGL02212:Spg11 APN 2 122108157 missense probably benign 0.31
IGL02605:Spg11 APN 2 122092260 missense probably benign 0.00
IGL02635:Spg11 APN 2 122113068 missense possibly damaging 0.52
IGL02743:Spg11 APN 2 122059507 missense probably damaging 0.97
IGL02822:Spg11 APN 2 122074534 missense probably damaging 0.99
IGL02992:Spg11 APN 2 122058398 missense probably damaging 1.00
IGL03010:Spg11 APN 2 122088320 missense probably damaging 0.96
3-1:Spg11 UTSW 2 122086890 missense probably damaging 0.98
PIT4354001:Spg11 UTSW 2 122088185 missense probably damaging 0.98
R0131:Spg11 UTSW 2 122070968 missense probably damaging 1.00
R0206:Spg11 UTSW 2 122055696 critical splice donor site probably null
R0208:Spg11 UTSW 2 122055696 critical splice donor site probably null
R0302:Spg11 UTSW 2 122092187 missense possibly damaging 0.90
R0347:Spg11 UTSW 2 122097369 missense probably damaging 0.99
R0357:Spg11 UTSW 2 122066232 splice site probably benign
R0372:Spg11 UTSW 2 122059447 frame shift probably null
R0715:Spg11 UTSW 2 122084983 missense probably benign 0.03
R0927:Spg11 UTSW 2 122094487 missense probably damaging 0.99
R1163:Spg11 UTSW 2 122070941 missense probably damaging 1.00
R1534:Spg11 UTSW 2 122092325 missense probably damaging 1.00
R1555:Spg11 UTSW 2 122097377 missense probably damaging 0.99
R1569:Spg11 UTSW 2 122101706 missense probably damaging 0.99
R1840:Spg11 UTSW 2 122101756 missense probably damaging 1.00
R1929:Spg11 UTSW 2 122060207 missense probably damaging 1.00
R2265:Spg11 UTSW 2 122108307 missense possibly damaging 0.48
R2303:Spg11 UTSW 2 122068837 missense probably damaging 0.99
R2510:Spg11 UTSW 2 122075310 missense probably benign 0.03
R2760:Spg11 UTSW 2 122097359 missense probably damaging 0.99
R2918:Spg11 UTSW 2 122075301 missense probably damaging 0.99
R3195:Spg11 UTSW 2 122083398 critical splice donor site probably null
R3423:Spg11 UTSW 2 122071053 missense probably benign 0.00
R4353:Spg11 UTSW 2 122113194 missense possibly damaging 0.92
R4407:Spg11 UTSW 2 122075332 missense probably benign 0.00
R4644:Spg11 UTSW 2 122061029 missense probably benign 0.03
R4684:Spg11 UTSW 2 122065076 missense probably damaging 1.00
R4771:Spg11 UTSW 2 122065482 nonsense probably null
R4810:Spg11 UTSW 2 122059796 missense probably damaging 1.00
R4829:Spg11 UTSW 2 122108455 missense probably benign 0.44
R5089:Spg11 UTSW 2 122114717 nonsense probably null
R5362:Spg11 UTSW 2 122061000 missense probably damaging 0.99
R5684:Spg11 UTSW 2 122093503 missense probably damaging 1.00
R5899:Spg11 UTSW 2 122098199 missense possibly damaging 0.67
R5923:Spg11 UTSW 2 122093478 missense probably damaging 0.98
R6052:Spg11 UTSW 2 122097356 missense probably damaging 0.99
R6111:Spg11 UTSW 2 122093482 missense probably damaging 0.98
R6174:Spg11 UTSW 2 122086805 intron probably null
R6226:Spg11 UTSW 2 122088262 missense possibly damaging 0.69
R6336:Spg11 UTSW 2 122112959 unclassified probably null
R6480:Spg11 UTSW 2 122092305 missense probably benign 0.03
R6494:Spg11 UTSW 2 122113225 missense probably damaging 0.98
R6582:Spg11 UTSW 2 122092292 missense probably damaging 0.99
R6714:Spg11 UTSW 2 122095731 missense probably damaging 0.99
R6791:Spg11 UTSW 2 122093443 missense probably damaging 0.99
R6836:Spg11 UTSW 2 122059535 missense probably damaging 1.00
R6928:Spg11 UTSW 2 122069904 missense probably benign 0.37
R7229:Spg11 UTSW 2 122108104 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ATGGCATGCCTCATCCTCAC -3'
(R):5'- ACTGCCACTAACATTTTGGATG -3'

Sequencing Primer
(F):5'- CACTGCTCTGACTAGTGGCATG -3'
(R):5'- GAGACAGTCTGGTGTTCCC -3'
Posted On2015-10-08