Incidental Mutation 'R4663:Sh3d19'
ID352987
Institutional Source Beutler Lab
Gene Symbol Sh3d19
Ensembl Gene ENSMUSG00000028082
Gene NameSH3 domain protein D19
SynonymsKryn
MMRRC Submission 041921-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4663 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location85971109-86130526 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 86123263 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 696 (D696N)
Ref Sequence ENSEMBL: ENSMUSP00000138320 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107664] [ENSMUST00000182666]
Predicted Effect probably benign
Transcript: ENSMUST00000107664
AA Change: D696N

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000103291
Gene: ENSMUSG00000028082
AA Change: D696N

DomainStartEndE-ValueType
low complexity region 336 361 N/A INTRINSIC
SH3 417 472 1.33e-3 SMART
SH3 497 552 1.88e-21 SMART
SH3 573 628 3.99e-16 SMART
SH3 663 718 2.8e-20 SMART
SH3 732 787 7.62e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182666
AA Change: D696N

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000138320
Gene: ENSMUSG00000028082
AA Change: D696N

DomainStartEndE-ValueType
low complexity region 336 361 N/A INTRINSIC
SH3 417 472 1.33e-3 SMART
SH3 497 552 1.88e-21 SMART
SH3 573 628 3.99e-16 SMART
SH3 663 718 2.8e-20 SMART
SH3 732 787 7.62e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183202
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multiple SH3 domain-containing protein, which interacts with other proteins, such as EBP and members of ADAM family, via the SH3 domains. This protein may be involved in suppression of Ras-induced cellular transformation and Ras-mediated activation of ELK1 by EBP, and regulation of ADAM proteins in the signaling of EGFR-ligand shedding. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,218,455 V1496A probably benign Het
Aqr A T 2: 114,161,666 Y76* probably null Het
Armc5 C A 7: 128,238,545 A140E probably benign Het
Auts2 T C 5: 131,439,638 H947R probably damaging Het
Bag2 T C 1: 33,746,993 T83A probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Bean1 A G 8: 104,211,167 Y126C probably damaging Het
Cars T C 7: 143,575,960 E330G probably damaging Het
Ccdc40 A G 11: 119,231,506 I45V probably benign Het
Cd320 G A 17: 33,848,178 G214R probably null Het
Ckm G A 7: 19,419,494 V237M probably damaging Het
Cspg4 T C 9: 56,886,676 V565A possibly damaging Het
Ephb6 A G 6: 41,617,865 Y638C probably damaging Het
Epp13 T G 7: 6,258,625 I35S possibly damaging Het
Fam196a A T 7: 134,899,148 Y409* probably null Het
Fat2 G C 11: 55,296,213 S1269* probably null Het
Fbxo3 T C 2: 104,053,475 V348A probably damaging Het
Gas6 G A 8: 13,470,254 P478L probably damaging Het
Gm11492 T A 11: 87,567,603 Y268N probably damaging Het
Herc1 T C 9: 66,433,378 S1670P probably damaging Het
Hnrnpk C A 13: 58,394,517 R281L probably damaging Het
Ifih1 C A 2: 62,609,219 C488F probably benign Het
Ift172 T C 5: 31,284,215 K192E probably benign Het
Ighv5-9 T A 12: 113,661,820 Q101L probably benign Het
Igkv3-2 G T 6: 70,698,879 M57I probably benign Het
Itpr2 A G 6: 146,373,173 F837S probably damaging Het
L3mbtl3 T C 10: 26,337,817 Y237C unknown Het
Lats1 G A 10: 7,712,583 C988Y probably damaging Het
Lgals3 T A 14: 47,381,622 probably null Het
Lrrc3b G T 14: 15,358,220 H129N probably benign Het
Lrriq1 T C 10: 103,063,412 H1656R possibly damaging Het
Lypd6 T G 2: 50,173,611 Y43* probably null Het
Mfsd7a T C 5: 108,442,145 M464V probably benign Het
Mical2 A G 7: 112,328,677 D674G possibly damaging Het
Msi1 G A 5: 115,450,275 R284Q probably damaging Het
Mybpc2 T C 7: 44,505,642 E947G probably damaging Het
Nat14 T A 7: 4,924,447 L206Q probably damaging Het
Nup88 A T 11: 70,965,846 probably null Het
Olfr27 A T 9: 39,144,849 I250F probably damaging Het
Olfr727 A G 14: 50,127,482 R302G probably benign Het
Olfr743 A T 14: 50,533,604 Y64F probably damaging Het
Pdcl T C 2: 37,355,766 E75G probably damaging Het
Phf14 A G 6: 11,953,422 I387V possibly damaging Het
Phf3 G A 1: 30,821,215 R845W probably damaging Het
Pm20d1 T C 1: 131,798,602 I59T probably damaging Het
Prkd1 C T 12: 50,419,848 probably null Het
Psmb2 T C 4: 126,677,765 L4P probably damaging Het
Pttg1 T A 11: 43,424,850 K46* probably null Het
Rrnad1 A G 3: 87,927,748 S82P probably damaging Het
Ryr2 T C 13: 11,749,509 H1401R possibly damaging Het
Slc16a2 T C X: 103,707,979 T274A probably benign Het
Slc26a6 G A 9: 108,857,907 A335T probably damaging Het
Slc6a5 C A 7: 49,938,398 Y493* probably null Het
Slf1 A T 13: 77,126,604 S37R probably damaging Het
Smoc1 G A 12: 81,167,602 G264S probably damaging Het
Snapc4 T C 2: 26,374,181 E280G possibly damaging Het
Snx25 G A 8: 46,035,579 T913M probably damaging Het
Snx7 T C 3: 117,800,879 T408A probably benign Het
Spdya T A 17: 71,578,344 S264R probably benign Het
Spg11 A T 2: 122,098,099 probably null Het
Suz12 T A 11: 80,013,524 L230Q probably damaging Het
Szt2 A G 4: 118,377,684 probably benign Het
Tenm3 C A 8: 48,235,970 R2194L probably damaging Het
Tmed8 T A 12: 87,174,231 I194F probably damaging Het
Tmem79 T A 3: 88,333,444 T66S probably damaging Het
Trappc1 T A 11: 69,325,511 S118T probably benign Het
Ttn C T 2: 76,738,881 V27223I probably benign Het
Ttn T C 2: 76,776,495 T18024A probably damaging Het
Vmn2r15 C T 5: 109,294,074 M164I probably benign Het
Vmn2r53 T A 7: 12,600,974 Y253F probably benign Het
Wdr92 T C 11: 17,232,853 V338A probably benign Het
Zfand6 C T 7: 84,617,885 R163H probably benign Het
Other mutations in Sh3d19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01415:Sh3d19 APN 3 86098185 missense probably benign 0.01
IGL01483:Sh3d19 APN 3 86114796 missense probably benign 0.09
IGL02272:Sh3d19 APN 3 86121167 missense probably benign 0.02
IGL02308:Sh3d19 APN 3 86093710 missense probably damaging 0.98
IGL02431:Sh3d19 APN 3 86106998 missense probably damaging 1.00
R0277:Sh3d19 UTSW 3 86126671 missense probably benign 0.00
R0323:Sh3d19 UTSW 3 86126671 missense probably benign 0.00
R0624:Sh3d19 UTSW 3 86114906 missense possibly damaging 0.96
R0639:Sh3d19 UTSW 3 86106973 missense probably benign 0.00
R0673:Sh3d19 UTSW 3 86106973 missense probably benign 0.00
R1148:Sh3d19 UTSW 3 86107327 missense possibly damaging 0.82
R1148:Sh3d19 UTSW 3 86107327 missense possibly damaging 0.82
R1569:Sh3d19 UTSW 3 86126644 missense possibly damaging 0.83
R1738:Sh3d19 UTSW 3 86120606 missense probably damaging 1.00
R3911:Sh3d19 UTSW 3 86107227 missense possibly damaging 0.62
R3913:Sh3d19 UTSW 3 86084776 missense probably damaging 0.97
R4246:Sh3d19 UTSW 3 86126688 missense probably benign 0.06
R4327:Sh3d19 UTSW 3 86123713 missense probably benign
R4730:Sh3d19 UTSW 3 86116864 missense possibly damaging 0.89
R4812:Sh3d19 UTSW 3 86123767 missense probably damaging 1.00
R4841:Sh3d19 UTSW 3 86123742 missense probably damaging 1.00
R4842:Sh3d19 UTSW 3 86123742 missense probably damaging 1.00
R5814:Sh3d19 UTSW 3 86126604 missense probably benign 0.00
R6279:Sh3d19 UTSW 3 86104102 missense possibly damaging 0.77
R6504:Sh3d19 UTSW 3 86085336 missense probably benign
R6806:Sh3d19 UTSW 3 86104333 missense probably damaging 0.99
R6916:Sh3d19 UTSW 3 86084911 missense probably benign 0.03
R7012:Sh3d19 UTSW 3 86085013 missense probably benign 0.01
R7147:Sh3d19 UTSW 3 86104277 missense possibly damaging 0.71
R7367:Sh3d19 UTSW 3 86104228 missense probably benign 0.21
X0027:Sh3d19 UTSW 3 86120703 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCACCACATTTGAAGCCTTGAG -3'
(R):5'- TCTCCACATAACTTTGATGCAGTAG -3'

Sequencing Primer
(F):5'- CACCACATTTGAAGCCTTGAGAAATG -3'
(R):5'- CTTTGATGCAGTAGTATAGAAGTGAC -3'
Posted On2015-10-08