Incidental Mutation 'R0271:Eml6'
ID35309
Institutional Source Beutler Lab
Gene Symbol Eml6
Ensembl Gene ENSMUSG00000044072
Gene Nameechinoderm microtubule associated protein like 6
Synonyms
MMRRC Submission 038497-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.214) question?
Stock #R0271 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location29743048-30026033 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 29848949 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 437 (V437A)
Ref Sequence ENSEMBL: ENSMUSP00000051080 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058902]
Predicted Effect possibly damaging
Transcript: ENSMUST00000058902
AA Change: V437A

PolyPhen 2 Score 0.480 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000051080
Gene: ENSMUSG00000044072
AA Change: V437A

DomainStartEndE-ValueType
low complexity region 36 47 N/A INTRINSIC
WD40 49 91 1.79e-1 SMART
WD40 94 136 1.42e-4 SMART
WD40 139 178 5.31e-4 SMART
WD40 184 224 8.84e1 SMART
WD40 225 263 3.75e-4 SMART
WD40 313 353 4.69e-5 SMART
WD40 356 394 2.22e0 SMART
WD40 397 436 1.72e0 SMART
WD40 505 546 1.7e2 SMART
WD40 552 592 4.55e-3 SMART
low complexity region 613 625 N/A INTRINSIC
Pfam:HELP 653 715 1.9e-22 PFAM
WD40 716 757 9.24e-1 SMART
WD40 760 802 6.53e-4 SMART
WD40 805 844 2.98e-1 SMART
WD40 856 891 8.52e1 SMART
WD40 892 929 2.09e-2 SMART
WD40 986 1026 1.18e-1 SMART
WD40 1032 1068 3.44e0 SMART
WD40 1071 1111 2.58e-1 SMART
WD40 1180 1221 9.24e-1 SMART
WD40 1227 1267 3.85e-1 SMART
low complexity region 1280 1291 N/A INTRINSIC
Pfam:HELP 1329 1402 5e-15 PFAM
WD40 1404 1447 2.66e0 SMART
WD40 1450 1492 1.85e0 SMART
WD40 1495 1534 2.97e0 SMART
WD40 1543 1582 7.1e1 SMART
WD40 1584 1629 9.51e1 SMART
WD40 1675 1715 3.05e-4 SMART
WD40 1718 1758 8.84e1 SMART
WD40 1759 1798 7.16e-1 SMART
WD40 1869 1910 1.53e1 SMART
WD40 1916 1956 4.62e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157510
Meta Mutation Damage Score 0.096 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.4%
  • 10x: 95.2%
  • 20x: 90.6%
Validation Efficiency 100% (65/65)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik T C 3: 88,686,329 probably benign Het
4930544D05Rik A G 11: 70,616,648 Q173R possibly damaging Het
Ampd2 C T 3: 108,086,716 probably benign Het
Ankrd17 T C 5: 90,254,799 S1467G possibly damaging Het
Arhgap31 T G 16: 38,602,510 S1065R possibly damaging Het
Arhgef19 G T 4: 141,250,607 M542I probably benign Het
C7 T C 15: 5,015,380 D392G possibly damaging Het
Ccdc138 G A 10: 58,575,823 C671Y probably damaging Het
Cdh8 A G 8: 99,111,715 S498P possibly damaging Het
Cpb2 T A 14: 75,257,709 probably null Het
Cwc22 A C 2: 77,920,858 N389K probably benign Het
Dgkb T A 12: 38,228,026 L550Q probably damaging Het
Dip2c A G 13: 9,615,775 R950G probably damaging Het
Fanca T C 8: 123,272,441 probably benign Het
Fgd2 C G 17: 29,367,008 L189V possibly damaging Het
Foxred2 A C 15: 77,943,390 S590A possibly damaging Het
Gm1110 A G 9: 26,920,666 F63S probably damaging Het
Gm14496 A T 2: 181,995,954 M274L probably benign Het
Gm7008 T A 12: 40,223,560 probably benign Het
Gm9922 T A 14: 101,729,553 probably benign Het
Gtf3c3 A T 1: 54,428,812 M222K possibly damaging Het
Hspa1b A G 17: 34,958,832 V59A probably benign Het
Impg1 T C 9: 80,386,879 probably benign Het
Lpcat4 T A 2: 112,243,245 probably null Het
Mipol1 T C 12: 57,460,954 probably benign Het
Mrpl37 C A 4: 107,066,461 R112L possibly damaging Het
Myo18b T C 5: 112,809,685 N1471D possibly damaging Het
Nes G A 3: 87,978,642 E1359K possibly damaging Het
Nipbl A T 15: 8,361,737 V251E possibly damaging Het
Nlrp1b T C 11: 71,161,765 I946V possibly damaging Het
Obscn T G 11: 59,056,742 probably benign Het
Olfr1024 A T 2: 85,904,289 M255K possibly damaging Het
Olfr1239 T A 2: 89,418,158 Y85F probably benign Het
Olfr1491 A T 19: 13,705,135 T103S probably benign Het
Olfr635 T A 7: 103,979,630 I146K possibly damaging Het
Pck2 T C 14: 55,544,584 probably null Het
Pcsk9 A G 4: 106,449,049 probably benign Het
Phyhd1 A T 2: 30,269,822 Q56L probably benign Het
Plxnc1 C T 10: 94,837,918 G1001S probably null Het
Prss52 T C 14: 64,113,678 V304A probably benign Het
Prss55 C T 14: 64,075,607 G276D probably benign Het
Pzp A T 6: 128,519,514 Y252N probably damaging Het
Rad1 T C 15: 10,490,457 probably null Het
Ripply3 A T 16: 94,335,757 E92D possibly damaging Het
Rpp30 T A 19: 36,104,403 D255E probably benign Het
Rsad1 T C 11: 94,548,464 probably benign Het
Serpini2 A G 3: 75,246,578 M358T probably damaging Het
Slc35a1 T A 4: 34,664,125 E331V probably benign Het
Slc38a7 A G 8: 95,845,878 F179L probably damaging Het
Stmn4 C T 14: 66,356,283 Q42* probably null Het
Sytl2 T C 7: 90,403,020 probably benign Het
Tab2 G A 10: 7,919,158 A520V probably benign Het
Tcp10a A G 17: 7,331,156 I162M probably benign Het
Tmprss13 A G 9: 45,333,688 probably benign Het
Tnfrsf14 A G 4: 154,926,597 probably null Het
Tpx2 A G 2: 152,867,367 probably benign Het
Vmn2r105 T A 17: 20,234,703 N57I probably damaging Het
Wars C T 12: 108,875,193 V220I probably benign Het
Washc1 T A 17: 66,116,719 D212E possibly damaging Het
Wdr17 C T 8: 54,693,096 A90T possibly damaging Het
Wdr43 A G 17: 71,626,825 D139G probably benign Het
Zfp235 A T 7: 24,137,131 H34L possibly damaging Het
Zkscan16 G A 4: 58,952,391 V230I probably benign Het
Other mutations in Eml6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01071:Eml6 APN 11 29850816 critical splice donor site probably null
IGL01407:Eml6 APN 11 29755021 nonsense probably null
IGL01434:Eml6 APN 11 29819090 missense probably damaging 1.00
IGL01578:Eml6 APN 11 29850870 missense probably benign 0.02
IGL01780:Eml6 APN 11 29805175 missense probably benign 0.17
IGL01821:Eml6 APN 11 29821699 missense probably benign 0.00
IGL01837:Eml6 APN 11 29777055 missense probably benign 0.00
IGL01904:Eml6 APN 11 29838613 nonsense probably null
IGL01972:Eml6 APN 11 29838451 missense possibly damaging 0.67
IGL02134:Eml6 APN 11 29759066 missense probably benign 0.13
IGL02192:Eml6 APN 11 29805743 missense probably benign 0.00
IGL02377:Eml6 APN 11 29777282 missense probably damaging 0.98
IGL02584:Eml6 APN 11 29749387 missense probably damaging 0.99
IGL02587:Eml6 APN 11 29784236 missense possibly damaging 0.92
IGL02810:Eml6 APN 11 29849016 missense possibly damaging 0.94
IGL02873:Eml6 APN 11 29880700 missense probably benign 0.10
IGL02880:Eml6 APN 11 29749959 missense probably benign 0.03
IGL03289:Eml6 APN 11 29795328 missense possibly damaging 0.49
IGL03301:Eml6 APN 11 29764083 missense probably benign 0.18
IGL03386:Eml6 APN 11 29749934 missense probably benign
IGL03407:Eml6 APN 11 29906330 missense probably damaging 1.00
PIT4453001:Eml6 UTSW 11 29802489 missense probably damaging 1.00
R0125:Eml6 UTSW 11 29882088 missense probably benign 0.19
R0240:Eml6 UTSW 11 29792367 missense possibly damaging 0.84
R0240:Eml6 UTSW 11 29792367 missense possibly damaging 0.84
R0304:Eml6 UTSW 11 29777441 missense probably benign 0.00
R0415:Eml6 UTSW 11 29749392 missense possibly damaging 0.84
R0449:Eml6 UTSW 11 29893213 missense probably benign 0.01
R0538:Eml6 UTSW 11 29760010 splice site probably benign
R0671:Eml6 UTSW 11 29805065 missense probably benign 0.00
R0766:Eml6 UTSW 11 29831219 splice site probably benign
R0800:Eml6 UTSW 11 29749877 missense probably benign 0.08
R0841:Eml6 UTSW 11 29777430 missense probably benign 0.41
R0879:Eml6 UTSW 11 29850816 critical splice donor site probably null
R1061:Eml6 UTSW 11 29777267 missense probably damaging 1.00
R1145:Eml6 UTSW 11 29777430 missense probably benign 0.41
R1145:Eml6 UTSW 11 29777430 missense probably benign 0.41
R1172:Eml6 UTSW 11 29749824 missense possibly damaging 0.54
R1173:Eml6 UTSW 11 29749824 missense possibly damaging 0.54
R1174:Eml6 UTSW 11 29749824 missense possibly damaging 0.54
R1199:Eml6 UTSW 11 29755044 missense possibly damaging 0.93
R1311:Eml6 UTSW 11 29831088 splice site probably benign
R1312:Eml6 UTSW 11 29831219 splice site probably benign
R1355:Eml6 UTSW 11 29833085 missense probably benign 0.03
R1370:Eml6 UTSW 11 29833085 missense probably benign 0.03
R1457:Eml6 UTSW 11 30024459 missense probably damaging 1.00
R1486:Eml6 UTSW 11 29805114 missense possibly damaging 0.83
R1511:Eml6 UTSW 11 29818374 missense probably damaging 1.00
R1532:Eml6 UTSW 11 29792256 splice site probably null
R1642:Eml6 UTSW 11 29777001 critical splice donor site probably null
R1682:Eml6 UTSW 11 29759065 missense probably benign 0.13
R1687:Eml6 UTSW 11 29833187 missense probably damaging 1.00
R1699:Eml6 UTSW 11 29746282 nonsense probably null
R1796:Eml6 UTSW 11 29881975 missense probably benign 0.19
R1797:Eml6 UTSW 11 29882041 missense probably benign 0.09
R1837:Eml6 UTSW 11 29749802 splice site probably null
R1874:Eml6 UTSW 11 29831136 missense probably damaging 0.99
R1967:Eml6 UTSW 11 30024545 missense probably damaging 1.00
R1969:Eml6 UTSW 11 29833075 missense probably benign
R2007:Eml6 UTSW 11 29848814 critical splice donor site probably null
R2012:Eml6 UTSW 11 29831128 missense possibly damaging 0.85
R2198:Eml6 UTSW 11 29850935 missense probably benign 0.01
R2217:Eml6 UTSW 11 29818907 missense probably damaging 1.00
R2218:Eml6 UTSW 11 29818907 missense probably damaging 1.00
R2403:Eml6 UTSW 11 29802434 missense probably benign 0.05
R2520:Eml6 UTSW 11 29791993 missense probably damaging 1.00
R2937:Eml6 UTSW 11 29833049 splice site probably benign
R2938:Eml6 UTSW 11 29833049 splice site probably benign
R3085:Eml6 UTSW 11 29809332 missense probably damaging 0.96
R3236:Eml6 UTSW 11 29831097 critical splice donor site probably null
R3738:Eml6 UTSW 11 29803137 missense probably benign 0.20
R3739:Eml6 UTSW 11 29803137 missense probably benign 0.20
R3752:Eml6 UTSW 11 29809360 missense probably benign 0.06
R3854:Eml6 UTSW 11 29749905 missense possibly damaging 0.76
R3941:Eml6 UTSW 11 29803167 missense probably damaging 0.98
R4034:Eml6 UTSW 11 29803137 missense probably benign 0.20
R4049:Eml6 UTSW 11 29838577 missense probably damaging 1.00
R4108:Eml6 UTSW 11 29805136 missense probably damaging 0.98
R4657:Eml6 UTSW 11 29805108 missense possibly damaging 0.77
R4662:Eml6 UTSW 11 29777390 missense probably damaging 1.00
R4665:Eml6 UTSW 11 29819007 nonsense probably null
R4721:Eml6 UTSW 11 29838525 missense possibly damaging 0.95
R4729:Eml6 UTSW 11 29833204 missense probably damaging 1.00
R4766:Eml6 UTSW 11 29805757 missense probably benign 0.22
R4810:Eml6 UTSW 11 29755011 missense possibly damaging 0.92
R4831:Eml6 UTSW 11 29777052 nonsense probably null
R5035:Eml6 UTSW 11 29854187 missense probably benign 0.00
R5064:Eml6 UTSW 11 29749300 missense probably benign 0.12
R5103:Eml6 UTSW 11 29850905 missense possibly damaging 0.65
R5121:Eml6 UTSW 11 29744606 missense probably benign 0.03
R5161:Eml6 UTSW 11 30024467 missense probably damaging 0.99
R5211:Eml6 UTSW 11 29854145 missense probably benign 0.02
R5268:Eml6 UTSW 11 29803108 missense probably benign 0.15
R5390:Eml6 UTSW 11 29760096 missense probably damaging 1.00
R5529:Eml6 UTSW 11 29764126 missense probably benign 0.04
R6239:Eml6 UTSW 11 29749275 missense probably damaging 1.00
R6326:Eml6 UTSW 11 29819066 missense probably damaging 1.00
R6395:Eml6 UTSW 11 29809321 missense probably benign 0.00
R6476:Eml6 UTSW 11 29791971 critical splice donor site probably null
R6483:Eml6 UTSW 11 29749875 missense probably benign 0.00
R6701:Eml6 UTSW 11 29785748 missense probably damaging 0.98
R6753:Eml6 UTSW 11 29754987 missense probably damaging 1.00
R6809:Eml6 UTSW 11 29803161 missense probably benign 0.23
R6847:Eml6 UTSW 11 29818447 missense probably benign 0.00
R6855:Eml6 UTSW 11 29751381 splice site probably null
R7168:Eml6 UTSW 11 29838529 missense probably benign 0.01
R7175:Eml6 UTSW 11 29784231 missense probably benign 0.00
R7305:Eml6 UTSW 11 29777258 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCCTGAGGTCACAGGACATTCTCTAC -3'
(R):5'- GGATTGTTATATTTACCCCGAGGGCAC -3'

Sequencing Primer
(F):5'- AGGACATTCTCTACCCTTTTGTGTG -3'
(R):5'- CCCGAGGGCACAAAATATTATTTC -3'
Posted On2013-05-09