Incidental Mutation 'R3782:Tmem62'
ID353167
Institutional Source Beutler Lab
Gene Symbol Tmem62
Ensembl Gene ENSMUSG00000054484
Gene Nametransmembrane protein 62
SynonymsB830009D23Rik
MMRRC Submission 040751-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.300) question?
Stock #R3782 (G1)
Quality Score73
Status Validated
Chromosome2
Chromosomal Location120977017-121007852 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 120977467 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 57 (W57R)
Ref Sequence ENSEMBL: ENSMUSP00000064310 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067582] [ENSMUST00000110686] [ENSMUST00000139428]
Predicted Effect probably damaging
Transcript: ENSMUST00000067582
AA Change: W57R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064310
Gene: ENSMUSG00000054484
AA Change: W57R

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:Metallophos 56 261 7.3e-11 PFAM
transmembrane domain 430 452 N/A INTRINSIC
transmembrane domain 479 501 N/A INTRINSIC
transmembrane domain 530 552 N/A INTRINSIC
transmembrane domain 573 595 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110686
SMART Domains Protein: ENSMUSP00000106314
Gene: ENSMUSG00000054484

DomainStartEndE-ValueType
transmembrane domain 300 322 N/A INTRINSIC
transmembrane domain 349 371 N/A INTRINSIC
transmembrane domain 400 422 N/A INTRINSIC
transmembrane domain 443 465 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123656
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130010
Predicted Effect probably damaging
Transcript: ENSMUST00000139428
AA Change: W57R

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000118808
Gene: ENSMUSG00000054484
AA Change: W57R

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
SCOP:d1utea_ 59 274 9e-9 SMART
low complexity region 308 327 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196757
Meta Mutation Damage Score 0.582 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency 100% (42/42)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aimp2 T A 5: 143,906,699 K24N possibly damaging Het
Atf6 A T 1: 170,794,767 Y428* probably null Het
BC034090 T C 1: 155,226,278 E80G probably damaging Het
Calcr T C 6: 3,700,193 T263A possibly damaging Het
Cdh7 T A 1: 110,049,004 V133E probably benign Het
Cpsf3 A C 12: 21,300,066 E262A possibly damaging Het
Ddx5 T C 11: 106,784,520 I330V probably benign Het
Dlg5 A G 14: 24,190,310 probably benign Het
Enam A T 5: 88,502,815 S653C probably damaging Het
Fndc3b A T 3: 27,459,986 V682D possibly damaging Het
Gm7075 T A 10: 63,421,693 H16L probably benign Het
Guf1 A T 5: 69,567,152 M396L probably benign Het
H2-Q10 A G 17: 35,471,018 Y179C possibly damaging Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Hpgd G A 8: 56,298,418 V94M probably damaging Het
Ktn1 G A 14: 47,706,403 probably benign Het
Lama5 T G 2: 180,194,563 H1165P possibly damaging Het
Lrrfip1 A G 1: 91,112,189 T205A possibly damaging Het
Mcm7 G A 5: 138,164,736 R385W probably damaging Het
Mgat4c A G 10: 102,388,921 E332G probably benign Het
Mpp7 A T 18: 7,351,085 H537Q probably damaging Het
Mx1 T C 16: 97,451,995 D380G possibly damaging Het
Nckap5 T A 1: 126,025,074 Q1183L possibly damaging Het
Nkx1-2 A G 7: 132,597,432 V200A probably damaging Het
Nr3c2 T A 8: 77,085,684 probably null Het
Nsmce1 C T 7: 125,486,377 V47I probably benign Het
Nudt3 A G 17: 27,580,808 S134P possibly damaging Het
Olfr1009 G A 2: 85,721,696 C97Y probably damaging Het
Olfr385 C A 11: 73,589,013 G242C probably damaging Het
Olfr385 A T 11: 73,589,368 Y123* probably null Het
Pcnx A G 12: 81,996,118 T2325A probably benign Het
Phactr4 A T 4: 132,367,867 probably null Het
Serpinb6d T A 13: 33,664,114 D20E probably benign Het
Spta1 A T 1: 174,208,314 Y1062F probably damaging Het
Ssc5d A G 7: 4,942,791 T941A probably benign Het
Taf11 A G 17: 27,903,193 probably benign Het
Tax1bp1 A G 6: 52,739,548 H286R probably damaging Het
Vmn2r111 T C 17: 22,571,320 Y235C possibly damaging Het
Vmn2r22 T A 6: 123,650,632 K2* probably null Het
Vmn2r74 A G 7: 85,956,114 V442A probably benign Het
Other mutations in Tmem62
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Tmem62 APN 2 121006964 unclassified probably null
IGL01011:Tmem62 APN 2 120979219 missense possibly damaging 0.48
IGL02125:Tmem62 APN 2 120996512 missense probably benign 0.01
IGL02430:Tmem62 APN 2 120986662 missense probably damaging 1.00
R0031:Tmem62 UTSW 2 120999113 missense probably benign 0.00
R0535:Tmem62 UTSW 2 121002596 missense possibly damaging 0.88
R1597:Tmem62 UTSW 2 120984362 missense probably benign 0.01
R1656:Tmem62 UTSW 2 121007002 missense probably benign 0.36
R1682:Tmem62 UTSW 2 121007057 missense probably benign 0.32
R1702:Tmem62 UTSW 2 120979227 missense probably damaging 1.00
R1755:Tmem62 UTSW 2 120984477 critical splice donor site probably null
R1886:Tmem62 UTSW 2 120986670 missense probably damaging 0.99
R1943:Tmem62 UTSW 2 120986626 missense probably benign 0.10
R2151:Tmem62 UTSW 2 120986862 missense probably damaging 1.00
R2419:Tmem62 UTSW 2 121007105 missense probably damaging 0.98
R3034:Tmem62 UTSW 2 120979124 splice site probably benign
R4326:Tmem62 UTSW 2 120980510 missense probably damaging 1.00
R4328:Tmem62 UTSW 2 120980510 missense probably damaging 1.00
R4620:Tmem62 UTSW 2 120996364 intron probably benign
R5168:Tmem62 UTSW 2 120993607 missense probably benign 0.16
R5625:Tmem62 UTSW 2 120990393 missense probably damaging 1.00
R6057:Tmem62 UTSW 2 120977462 missense probably damaging 0.98
R6386:Tmem62 UTSW 2 120999114 missense probably benign 0.00
R7038:Tmem62 UTSW 2 120993577 missense possibly damaging 0.87
R7182:Tmem62 UTSW 2 121004743 missense probably benign 0.08
X0052:Tmem62 UTSW 2 120993528 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTAGGTTGTCAAACGCCGG -3'
(R):5'- TATCTGAGTCAGGAAGAGCCGC -3'

Sequencing Primer
(F):5'- TTGTCAAACGCCGGGCAAC -3'
(R):5'- AGGAAGAGCCGCACCGAC -3'
Posted On2015-10-20