Incidental Mutation 'R3406:Muc6'
ID353173
Institutional Source Beutler Lab
Gene Symbol Muc6
Ensembl Gene ENSMUSG00000048191
Gene Namemucin 6, gastric
Synonyms
MMRRC Submission 040624-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.496) question?
Stock #R3406 (G1)
Quality Score32
Status Validated
Chromosome7
Chromosomal Location141633456-141655319 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 141638400 bp
ZygosityHeterozygous
Amino Acid Change Serine to Phenylalanine at position 2120 (S2120F)
Ref Sequence ENSEMBL: ENSMUSP00000140483 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062451] [ENSMUST00000189314] [ENSMUST00000190907]
Predicted Effect possibly damaging
Transcript: ENSMUST00000062451
AA Change: S2055F

PolyPhen 2 Score 0.848 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000049941
Gene: ENSMUSG00000048191
AA Change: S2055F

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
VWD 29 234 2.49e-14 SMART
C8 267 340 5.46e-3 SMART
Pfam:TIL 344 399 5.6e-14 PFAM
VWC 401 469 2.57e-7 SMART
VWD 428 591 4.81e-30 SMART
C8 627 703 8.84e-21 SMART
SCOP:d1coua_ 706 769 7e-9 SMART
Pfam:TIL 806 869 1.9e-9 PFAM
VWC 871 941 8.52e-3 SMART
VWD 898 1060 1.59e-30 SMART
C8 1096 1170 5.52e-31 SMART
Blast:CT 1184 1236 2e-19 BLAST
low complexity region 1240 1269 N/A INTRINSIC
low complexity region 1275 1293 N/A INTRINSIC
low complexity region 1313 1337 N/A INTRINSIC
low complexity region 1345 1374 N/A INTRINSIC
internal_repeat_3 1375 1560 6.78e-17 PROSPERO
internal_repeat_2 1426 1751 8.94e-34 PROSPERO
low complexity region 1761 1780 N/A INTRINSIC
low complexity region 1867 1887 N/A INTRINSIC
low complexity region 1896 1910 N/A INTRINSIC
low complexity region 1912 1946 N/A INTRINSIC
low complexity region 1990 2004 N/A INTRINSIC
low complexity region 2010 2020 N/A INTRINSIC
internal_repeat_2 2036 2430 8.94e-34 PROSPERO
internal_repeat_3 2329 2516 6.78e-17 PROSPERO
low complexity region 2519 2536 N/A INTRINSIC
low complexity region 2564 2587 N/A INTRINSIC
low complexity region 2605 2630 N/A INTRINSIC
low complexity region 2642 2677 N/A INTRINSIC
low complexity region 2729 2762 N/A INTRINSIC
Blast:CT 2765 2852 1e-44 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000189314
SMART Domains Protein: ENSMUSP00000140388
Gene: ENSMUSG00000048191

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
VWD 29 193 2.64e-27 SMART
C8 226 299 5.46e-3 SMART
Pfam:TIL 303 358 1.4e-13 PFAM
VWC 360 428 2.57e-7 SMART
VWD 387 550 4.81e-30 SMART
C8 586 662 8.84e-21 SMART
internal_repeat_2 665 754 5.76e-7 PROSPERO
Pfam:TIL 765 828 6.4e-9 PFAM
VWC 830 900 8.52e-3 SMART
VWD 857 1019 1.59e-30 SMART
C8 1055 1129 5.52e-31 SMART
low complexity region 1199 1228 N/A INTRINSIC
low complexity region 1234 1252 N/A INTRINSIC
low complexity region 1272 1296 N/A INTRINSIC
low complexity region 1304 1333 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000190907
AA Change: S2120F

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000140483
Gene: ENSMUSG00000048191
AA Change: S2120F

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
VWD 29 234 1.2e-16 SMART
C8 267 340 4.2e-7 SMART
Pfam:TIL 344 399 7.2e-11 PFAM
VWC_def 401 469 1.2e-9 SMART
VWD 428 591 2.4e-32 SMART
C8 627 703 6.7e-25 SMART
SCOP:d1coua_ 706 769 5e-9 SMART
Pfam:TIL 806 869 3.3e-6 PFAM
VWC_def 871 941 4.1e-5 SMART
VWD 898 1060 7.7e-33 SMART
C8 1096 1170 4.2e-35 SMART
Blast:CT 1184 1236 2e-19 BLAST
low complexity region 1240 1269 N/A INTRINSIC
low complexity region 1275 1293 N/A INTRINSIC
low complexity region 1313 1337 N/A INTRINSIC
low complexity region 1345 1374 N/A INTRINSIC
low complexity region 1406 1419 N/A INTRINSIC
internal_repeat_1 1426 1822 3.44e-48 PROSPERO
low complexity region 1826 1845 N/A INTRINSIC
low complexity region 1932 1952 N/A INTRINSIC
low complexity region 1961 1975 N/A INTRINSIC
low complexity region 1977 2011 N/A INTRINSIC
low complexity region 2055 2069 N/A INTRINSIC
low complexity region 2075 2085 N/A INTRINSIC
internal_repeat_1 2101 2501 3.44e-48 PROSPERO
low complexity region 2504 2524 N/A INTRINSIC
low complexity region 2584 2601 N/A INTRINSIC
low complexity region 2629 2652 N/A INTRINSIC
low complexity region 2670 2695 N/A INTRINSIC
low complexity region 2707 2742 N/A INTRINSIC
low complexity region 2794 2827 N/A INTRINSIC
Blast:CT 2830 2917 1e-44 BLAST
Meta Mutation Damage Score 0.0552 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.4%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mucin protein family. Mucins are high molecular weight glycoproteins produced by many epithelial tissues. The protein encoded by this gene is secreted and forms an insoluble mucous barrier that protects the gut lumen. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd18 T A 3: 40,904,903 M1K probably null Het
Bdkrb2 T C 12: 105,592,496 V332A possibly damaging Het
Cdc27 T C 11: 104,507,200 E778G probably damaging Het
Chd4 C A 6: 125,122,007 T1586K probably benign Het
Cnga3 A G 1: 37,262,065 E622G probably benign Het
Dbh A G 2: 27,174,965 D396G possibly damaging Het
Dhodh G A 8: 109,603,475 R86* probably null Het
Dpt A C 1: 164,796,931 E67A probably damaging Het
Eif2ak2 A G 17: 78,858,639 probably benign Het
Esp4 T A 17: 40,602,445 L68M possibly damaging Het
Exo1 A G 1: 175,905,970 K787E possibly damaging Het
Fbxo38 T C 18: 62,514,843 T875A probably damaging Het
Gm5346 A T 8: 43,626,052 C378* probably null Het
Gsdma T C 11: 98,673,138 probably benign Het
Hemk1 G A 9: 107,337,216 Q6* probably null Het
Hmcn2 C T 2: 31,433,272 probably benign Het
Hook2 A G 8: 84,993,984 probably benign Het
Irx3 A G 8: 91,798,927 S507P unknown Het
Kazn C A 4: 142,239,195 probably benign Het
Kcne4 C T 1: 78,817,971 A112V possibly damaging Het
Lamb1 C T 12: 31,287,529 R372C probably damaging Het
Lrrc30 A G 17: 67,632,180 L135P probably damaging Het
Lyst T A 13: 13,635,230 M495K possibly damaging Het
Mab21l3 C A 3: 101,823,531 V131F probably damaging Het
Mki67 T A 7: 135,707,475 T416S probably benign Het
Mlst8 A T 17: 24,478,125 M56K probably benign Het
Mmp9 A G 2: 164,949,390 Y160C probably damaging Het
Mslnl A G 17: 25,746,181 Y507C probably damaging Het
Myl12a A T 17: 70,994,742 M130K probably benign Het
Ncdn C T 4: 126,748,595 R423Q probably benign Het
Ncf2 A G 1: 152,825,947 probably benign Het
Nek8 G T 11: 78,170,746 S319* probably null Het
Olfr553 T C 7: 102,614,786 M68V possibly damaging Het
Olfr740 G A 14: 50,453,196 C48Y probably benign Het
Pcdh17 T A 14: 84,446,622 D176E probably damaging Het
Pcdhb15 C A 18: 37,475,389 A558E probably benign Het
Plrg1 T A 3: 83,071,219 W431R probably damaging Het
Rbfox3 T A 11: 118,496,457 Q277L possibly damaging Het
Rpgrip1 G A 14: 52,145,209 D600N possibly damaging Het
Siah3 A G 14: 75,525,981 D224G probably damaging Het
Slc22a6 T C 19: 8,621,311 L244P probably damaging Het
Stap2 A T 17: 55,997,511 W374R probably benign Het
Tbck T A 3: 132,727,084 N418K probably benign Het
Tcp11x2 T C X: 135,654,984 N474S probably damaging Het
Tenm3 A C 8: 48,228,555 V2680G probably damaging Het
Thada A T 17: 84,230,785 probably benign Het
Tlr6 C T 5: 64,953,429 V712M probably damaging Het
Tmem28 A G X: 99,845,503 I325V probably benign Het
Uvssa G T 5: 33,389,818 G243C probably damaging Het
Vwa8 T A 14: 79,164,220 probably benign Het
Znrf2 A T 6: 54,884,791 N229I probably damaging Het
Other mutations in Muc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Muc6 APN 7 141638584 missense probably benign 0.06
IGL00466:Muc6 APN 7 141645902 missense possibly damaging 0.94
IGL00990:Muc6 APN 7 141638890 missense possibly damaging 0.85
IGL01013:Muc6 APN 7 141648066 nonsense probably null
IGL01021:Muc6 APN 7 141637162 missense possibly damaging 0.53
IGL01061:Muc6 APN 7 141648454 missense probably damaging 1.00
IGL01294:Muc6 APN 7 141646659 missense probably damaging 1.00
IGL01449:Muc6 APN 7 141638614 missense possibly damaging 0.92
IGL01474:Muc6 APN 7 141651307 missense probably damaging 1.00
IGL01539:Muc6 APN 7 141650041 missense probably benign 0.07
IGL01541:Muc6 APN 7 141649804 nonsense probably null
IGL01810:Muc6 APN 7 141651062 missense probably damaging 0.97
IGL01941:Muc6 APN 7 141638584 missense probably benign 0.06
IGL01954:Muc6 APN 7 141638584 missense probably benign 0.06
IGL02096:Muc6 APN 7 141639850 intron probably benign
IGL02192:Muc6 APN 7 141637804 missense possibly damaging 0.91
IGL02217:Muc6 APN 7 141649624 missense probably damaging 1.00
IGL02234:Muc6 APN 7 141640575 missense probably benign 0.09
IGL02302:Muc6 APN 7 141641496 missense possibly damaging 0.53
IGL02331:Muc6 APN 7 141640459 missense possibly damaging 0.53
IGL02531:Muc6 APN 7 141636940 missense possibly damaging 0.53
IGL02639:Muc6 APN 7 141649578 splice site probably benign
IGL02851:Muc6 APN 7 141648361 missense probably damaging 1.00
IGL03026:Muc6 APN 7 141640147 intron probably benign
IGL03070:Muc6 APN 7 141644567 splice site probably benign
IGL03108:Muc6 APN 7 141637489 missense possibly damaging 0.93
IGL03350:Muc6 APN 7 141652059 missense probably damaging 1.00
IGL03366:Muc6 APN 7 141648082 missense probably damaging 1.00
F5770:Muc6 UTSW 7 141647613 missense probably benign 0.11
IGL03147:Muc6 UTSW 7 141638400 missense possibly damaging 0.95
R0001:Muc6 UTSW 7 141641574 missense possibly damaging 0.53
R0005:Muc6 UTSW 7 141638772 missense possibly damaging 0.72
R0147:Muc6 UTSW 7 141651990 missense probably damaging 1.00
R0153:Muc6 UTSW 7 141634116 missense possibly damaging 0.68
R0227:Muc6 UTSW 7 141639559 intron probably benign
R0234:Muc6 UTSW 7 141649674 missense possibly damaging 0.95
R0234:Muc6 UTSW 7 141649674 missense possibly damaging 0.95
R0304:Muc6 UTSW 7 141638400 missense possibly damaging 0.95
R0379:Muc6 UTSW 7 141636955 missense possibly damaging 0.53
R0385:Muc6 UTSW 7 141638400 missense possibly damaging 0.95
R0423:Muc6 UTSW 7 141652283 missense probably benign 0.01
R0499:Muc6 UTSW 7 141640468 missense probably benign
R0503:Muc6 UTSW 7 141638772 missense possibly damaging 0.72
R0757:Muc6 UTSW 7 141638584 missense probably benign 0.06
R0792:Muc6 UTSW 7 141639559 intron probably benign
R0880:Muc6 UTSW 7 141637357 missense possibly damaging 0.91
R1136:Muc6 UTSW 7 141638772 missense possibly damaging 0.72
R1170:Muc6 UTSW 7 141644233 missense probably damaging 0.99
R1174:Muc6 UTSW 7 141648101 missense probably damaging 1.00
R1175:Muc6 UTSW 7 141648101 missense probably damaging 1.00
R1189:Muc6 UTSW 7 141645855 missense probably damaging 1.00
R1259:Muc6 UTSW 7 141640197 intron probably benign
R1293:Muc6 UTSW 7 141651990 missense probably damaging 1.00
R1295:Muc6 UTSW 7 141651879 missense probably benign 0.04
R1296:Muc6 UTSW 7 141651879 missense probably benign 0.04
R1471:Muc6 UTSW 7 141647909 missense possibly damaging 0.61
R1472:Muc6 UTSW 7 141651879 missense probably benign 0.04
R1548:Muc6 UTSW 7 141652103 splice site probably benign
R1548:Muc6 UTSW 7 141638772 missense possibly damaging 0.72
R1576:Muc6 UTSW 7 141634524 missense possibly damaging 0.92
R1689:Muc6 UTSW 7 141647998 missense probably damaging 1.00
R1702:Muc6 UTSW 7 141650487 missense probably damaging 1.00
R1792:Muc6 UTSW 7 141634458 missense probably benign 0.41
R1924:Muc6 UTSW 7 141638400 missense possibly damaging 0.95
R1938:Muc6 UTSW 7 141637098 missense probably damaging 0.99
R1964:Muc6 UTSW 7 141640062 nonsense probably null
R1964:Muc6 UTSW 7 141640063 intron probably benign
R1975:Muc6 UTSW 7 141648101 missense probably damaging 1.00
R2031:Muc6 UTSW 7 141638400 missense possibly damaging 0.95
R2104:Muc6 UTSW 7 141634078 missense probably benign 0.23
R2201:Muc6 UTSW 7 141649810 missense probably damaging 1.00
R2218:Muc6 UTSW 7 141646960 missense probably benign 0.41
R2245:Muc6 UTSW 7 141638400 missense possibly damaging 0.95
R2261:Muc6 UTSW 7 141638400 missense possibly damaging 0.95
R2271:Muc6 UTSW 7 141637510 missense possibly damaging 0.53
R2272:Muc6 UTSW 7 141637510 missense possibly damaging 0.53
R2284:Muc6 UTSW 7 141637924 missense possibly damaging 0.53
R2310:Muc6 UTSW 7 141637531 missense possibly damaging 0.53
R2566:Muc6 UTSW 7 141640384 missense possibly damaging 0.73
R2975:Muc6 UTSW 7 141637038 missense possibly damaging 0.86
R3423:Muc6 UTSW 7 141638400 missense possibly damaging 0.95
R3548:Muc6 UTSW 7 141638400 missense possibly damaging 0.95
R3693:Muc6 UTSW 7 141648681 splice site probably benign
R3872:Muc6 UTSW 7 141640600 missense probably benign
R4029:Muc6 UTSW 7 141638400 missense possibly damaging 0.95
R4084:Muc6 UTSW 7 141648655 missense probably damaging 1.00
R4126:Muc6 UTSW 7 141638400 missense possibly damaging 0.95
R4410:Muc6 UTSW 7 141637663 missense possibly damaging 0.91
R4508:Muc6 UTSW 7 141640089 intron probably benign
R4509:Muc6 UTSW 7 141638400 missense possibly damaging 0.95
R4518:Muc6 UTSW 7 141644222 missense probably benign 0.03
R4594:Muc6 UTSW 7 141638772 missense possibly damaging 0.72
R4677:Muc6 UTSW 7 141639790 intron probably benign
R4678:Muc6 UTSW 7 141644287 missense probably benign 0.09
R4737:Muc6 UTSW 7 141640159 intron probably benign
R4737:Muc6 UTSW 7 141638772 missense possibly damaging 0.72
R4981:Muc6 UTSW 7 141638400 missense possibly damaging 0.95
R5008:Muc6 UTSW 7 141639559 intron probably benign
R5012:Muc6 UTSW 7 141636657 missense possibly damaging 0.96
R5017:Muc6 UTSW 7 141640528 missense probably benign
R5027:Muc6 UTSW 7 141636436 missense probably benign 0.01
R5058:Muc6 UTSW 7 141644224 missense probably benign 0.01
R5069:Muc6 UTSW 7 141651299 missense probably damaging 1.00
R5126:Muc6 UTSW 7 141651299 missense probably damaging 1.00
R5168:Muc6 UTSW 7 141639559 intron probably benign
R5179:Muc6 UTSW 7 141638772 missense possibly damaging 0.72
R5198:Muc6 UTSW 7 141638772 missense possibly damaging 0.72
R5262:Muc6 UTSW 7 141651110 missense possibly damaging 0.78
R5381:Muc6 UTSW 7 141637923 missense possibly damaging 0.86
R5454:Muc6 UTSW 7 141648813 missense possibly damaging 0.61
R5467:Muc6 UTSW 7 141636535 missense possibly damaging 0.53
R5540:Muc6 UTSW 7 141649585 critical splice donor site probably null
R5800:Muc6 UTSW 7 141640423 splice site probably benign
R5808:Muc6 UTSW 7 141640093 intron probably benign
R5865:Muc6 UTSW 7 141650504 missense probably damaging 0.97
R5919:Muc6 UTSW 7 141641570 missense possibly damaging 0.56
R6024:Muc6 UTSW 7 141641574 missense possibly damaging 0.53
R6064:Muc6 UTSW 7 141648374 missense probably damaging 1.00
R6126:Muc6 UTSW 7 141638772 missense possibly damaging 0.72
R6229:Muc6 UTSW 7 141640525 missense probably benign
R6236:Muc6 UTSW 7 141638772 missense possibly damaging 0.72
R6245:Muc6 UTSW 7 141648821 missense probably damaging 1.00
R6254:Muc6 UTSW 7 141651115 missense probably benign 0.09
R6418:Muc6 UTSW 7 141639610 intron probably benign
R6609:Muc6 UTSW 7 141640433 splice site probably benign
R6610:Muc6 UTSW 7 141640433 splice site probably benign
R6611:Muc6 UTSW 7 141640433 splice site probably benign
R6623:Muc6 UTSW 7 141639559 intron probably benign
R6626:Muc6 UTSW 7 141639559 intron probably benign
R6817:Muc6 UTSW 7 141651061 missense probably damaging 0.99
R6923:Muc6 UTSW 7 141637540 missense possibly damaging 0.91
R6989:Muc6 UTSW 7 141639979 intron probably benign
V7581:Muc6 UTSW 7 141647613 missense probably benign 0.11
V7583:Muc6 UTSW 7 141647613 missense probably benign 0.11
X0026:Muc6 UTSW 7 141651699 missense possibly damaging 0.94
X0058:Muc6 UTSW 7 141638400 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGTACTGTCCCAGACACAGC -3'
(R):5'- TCTGTGACACCAACTTCTGAG -3'

Sequencing Primer
(F):5'- CCACAGTGGTTGAAGGGTG -3'
(R):5'- TTCTGAGGTAATTATCACCCCAAC -3'
Posted On2015-10-21