Incidental Mutation 'R4710:Ap1b1'
ID353219
Institutional Source Beutler Lab
Gene Symbol Ap1b1
Ensembl Gene ENSMUSG00000009090
Gene Nameadaptor protein complex AP-1, beta 1 subunit
SynonymsAdtb1, beta-prime adaptin
MMRRC Submission 042019-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.663) question?
Stock #R4710 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location4986824-5042791 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 5031664 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 524 (Y524C)
Ref Sequence ENSEMBL: ENSMUSP00000009234 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009234] [ENSMUST00000101613] [ENSMUST00000109897]
Predicted Effect probably damaging
Transcript: ENSMUST00000009234
AA Change: Y524C

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000009234
Gene: ENSMUSG00000009090
AA Change: Y524C

DomainStartEndE-ValueType
Pfam:Adaptin_N 10 534 1.5e-174 PFAM
Pfam:HEAT_2 88 157 3.2e-8 PFAM
Pfam:Cnd1 99 268 4.1e-41 PFAM
low complexity region 594 616 N/A INTRINSIC
low complexity region 626 638 N/A INTRINSIC
low complexity region 657 670 N/A INTRINSIC
low complexity region 674 686 N/A INTRINSIC
Alpha_adaptinC2 713 823 3.38e-18 SMART
B2-adapt-app_C 832 942 4.6e-51 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000101613
AA Change: Y497C

PolyPhen 2 Score 0.838 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000099134
Gene: ENSMUSG00000009090
AA Change: Y497C

DomainStartEndE-ValueType
Pfam:Adaptin_N 10 179 7.5e-61 PFAM
Pfam:HEAT_2 88 179 2e-9 PFAM
Pfam:Cnd1 99 176 2.4e-19 PFAM
Pfam:Cnd1 174 241 1.9e-10 PFAM
Pfam:Adaptin_N 176 507 3.8e-102 PFAM
low complexity region 567 589 N/A INTRINSIC
low complexity region 599 611 N/A INTRINSIC
low complexity region 630 642 N/A INTRINSIC
low complexity region 654 666 N/A INTRINSIC
Alpha_adaptinC2 693 803 3.38e-18 SMART
B2-adapt-app_C 812 922 4.6e-51 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000109897
AA Change: Y497C

PolyPhen 2 Score 0.838 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105523
Gene: ENSMUSG00000009090
AA Change: Y497C

DomainStartEndE-ValueType
Pfam:Adaptin_N 10 179 1.2e-60 PFAM
Pfam:HEAT_2 88 185 3.9e-10 PFAM
Pfam:Cnd1 99 175 5e-20 PFAM
Pfam:Cnd1 174 241 1.7e-7 PFAM
Pfam:Adaptin_N 176 507 4.9e-102 PFAM
low complexity region 567 589 N/A INTRINSIC
low complexity region 599 611 N/A INTRINSIC
low complexity region 630 643 N/A INTRINSIC
low complexity region 647 659 N/A INTRINSIC
Alpha_adaptinC2 686 796 3.38e-18 SMART
B2-adapt-app_C 805 915 4.6e-51 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145704
Meta Mutation Damage Score 0.336 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 99% (75/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adaptor protein complex 1 is found at the cytoplasmic face of coated vesicles located at the Golgi complex, where it mediates both the recruitment of clathrin to the membrane and the recognition of sorting signals within the cytosolic tails of transmembrane receptors. This complex is a heterotetramer composed of two large, one medium, and one small adaptin subunit. The protein encoded by this gene serves as one of the large subunits of this complex and is a member of the adaptin protein family. This gene is a candidate meningioma gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,641,303 Q185L probably benign Het
Acaca T A 11: 84,392,337 I2243N possibly damaging Het
Adamts18 A G 8: 113,706,926 S1059P probably damaging Het
Aox4 A T 1: 58,255,638 K1002M probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Bpifb6 T A 2: 153,908,516 I309N possibly damaging Het
Cd209b T C 8: 3,924,215 E99G probably damaging Het
Cntn2 T A 1: 132,528,225 H185L possibly damaging Het
Col4a2 C A 8: 11,409,462 P299Q probably benign Het
Commd3 A G 2: 18,674,282 N106S probably benign Het
Coro7 T G 16: 4,634,933 probably benign Het
Ctf1 C A 7: 127,717,080 P66Q probably damaging Het
Dclre1c T C 2: 3,440,861 probably null Het
Dnaaf3 A T 7: 4,526,494 L317Q probably damaging Het
Dnah2 A G 11: 69,478,077 L1667P probably damaging Het
Dpp4 A G 2: 62,360,315 I399T probably benign Het
Dysf C A 6: 84,097,715 D499E probably damaging Het
Erg T C 16: 95,390,034 D90G possibly damaging Het
F11 T C 8: 45,250,146 Y169C probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fcgbp A T 7: 28,094,961 M1197L probably benign Het
Gimd1 T C 3: 132,634,848 S42P possibly damaging Het
Gm12666 T C 4: 92,190,975 E203G possibly damaging Het
Gm5526 T A 1: 45,857,419 noncoding transcript Het
Gnl2 T A 4: 125,053,459 S625T probably benign Het
H2-Q2 A G 17: 35,343,302 E175G probably damaging Het
Hmgxb3 G A 18: 61,137,475 P926S probably damaging Het
Ifi213 G A 1: 173,567,172 probably benign Het
Inhba T C 13: 16,026,483 V210A probably benign Het
Kansl1l G A 1: 66,801,496 A215V possibly damaging Het
Kcnk1 T A 8: 126,029,528 V263D probably damaging Het
Kcnk9 A G 15: 72,512,975 I118T probably damaging Het
Lamb1 A G 12: 31,282,583 I283V probably benign Het
Lias A G 5: 65,397,727 D88G probably benign Het
Lrrk2 G A 15: 91,699,927 V297M possibly damaging Het
Maea C T 5: 33,368,690 R237C probably benign Het
Mdfi T A 17: 47,824,586 N73I probably damaging Het
Mphosph6 T A 8: 117,801,902 M1L probably damaging Het
Mta2 T A 19: 8,949,153 I486N probably damaging Het
Nbr1 C T 11: 101,575,275 P769L probably damaging Het
Ncam2 T A 16: 81,465,706 probably null Het
Ndel1 A G 11: 68,845,337 Y26H probably damaging Het
Neb T C 2: 52,260,598 R2473G probably benign Het
Olfr1115 T A 2: 87,252,040 D34E possibly damaging Het
Olfr140 T C 2: 90,052,150 Y58C probably damaging Het
Olfr187 T A 16: 59,036,275 H154L possibly damaging Het
Olfr213 T C 6: 116,540,650 Y66H possibly damaging Het
Olfr325 A T 11: 58,581,722 I293F probably damaging Het
Olfr459 G T 6: 41,771,508 Q264K probably benign Het
Park2 A C 17: 11,854,833 Q346P possibly damaging Het
Prrc2b T A 2: 32,193,857 S236R possibly damaging Het
Rae1 G T 2: 173,015,392 probably benign Het
Rnf112 T C 11: 61,449,831 D491G probably damaging Het
Rnf220 C T 4: 117,289,214 probably benign Het
Ryr3 G A 2: 112,766,301 L2483F probably damaging Het
Sema6a T C 18: 47,270,683 N624S probably benign Het
Sgms1 C T 19: 32,160,137 V10M probably damaging Het
Slc23a2 T C 2: 132,056,709 N636S probably benign Het
Slc25a48 C T 13: 56,463,566 T162I probably damaging Het
Smtn G A 11: 3,524,663 S716F probably damaging Het
Snrnp200 T C 2: 127,226,133 L850P probably damaging Het
Sost G A 11: 101,966,844 P44S probably damaging Het
Sox18 A G 2: 181,670,895 Y148H probably damaging Het
Stk-ps1 A G 17: 36,397,670 noncoding transcript Het
Tas2r104 T A 6: 131,685,444 T101S probably damaging Het
Traf3ip2 C T 10: 39,639,260 P345S possibly damaging Het
Ttn A G 2: 76,752,084 Y22822H probably damaging Het
Vmn2r4 A G 3: 64,409,780 probably null Het
Vmn2r53 T A 7: 12,601,202 H177L probably benign Het
Zbtb20 G T 16: 43,610,676 A517S probably damaging Het
Zfat A T 15: 68,180,282 D554E probably benign Het
Zfp719 C T 7: 43,590,232 H415Y probably damaging Het
Other mutations in Ap1b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01759:Ap1b1 APN 11 5019433 missense probably damaging 1.00
IGL01843:Ap1b1 APN 11 5039169 missense probably damaging 1.00
IGL01981:Ap1b1 APN 11 5019336 missense possibly damaging 0.84
IGL02055:Ap1b1 APN 11 5024452 nonsense probably null
IGL02318:Ap1b1 APN 11 5019294 missense probably benign 0.14
IGL02505:Ap1b1 APN 11 5031700 missense probably benign 0.11
IGL02824:Ap1b1 APN 11 5033738 missense possibly damaging 0.47
IGL02825:Ap1b1 APN 11 5033738 missense possibly damaging 0.47
IGL02963:Ap1b1 APN 11 5033738 missense possibly damaging 0.47
PIT4142001:Ap1b1 UTSW 11 5040360 missense probably damaging 1.00
R0321:Ap1b1 UTSW 11 5032464 missense probably benign
R0477:Ap1b1 UTSW 11 5031787 missense probably benign 0.13
R0622:Ap1b1 UTSW 11 5037707 missense probably damaging 0.96
R0831:Ap1b1 UTSW 11 5023092 splice site probably benign
R1502:Ap1b1 UTSW 11 5040290 missense probably benign
R1529:Ap1b1 UTSW 11 5039547 missense probably damaging 1.00
R2110:Ap1b1 UTSW 11 5015613 missense probably damaging 0.99
R2112:Ap1b1 UTSW 11 5015613 missense probably damaging 0.99
R2186:Ap1b1 UTSW 11 5015737 missense possibly damaging 0.84
R2906:Ap1b1 UTSW 11 5031641 missense probably damaging 1.00
R2907:Ap1b1 UTSW 11 5031641 missense probably damaging 1.00
R2908:Ap1b1 UTSW 11 5031641 missense probably damaging 1.00
R3154:Ap1b1 UTSW 11 5023135 missense possibly damaging 0.95
R3611:Ap1b1 UTSW 11 5024427 missense possibly damaging 0.87
R3805:Ap1b1 UTSW 11 5033225 intron probably null
R4207:Ap1b1 UTSW 11 5031637 missense probably damaging 0.96
R4660:Ap1b1 UTSW 11 5016760 missense probably damaging 1.00
R4826:Ap1b1 UTSW 11 5018043 missense probably benign 0.11
R4914:Ap1b1 UTSW 11 5024400 missense possibly damaging 0.73
R5086:Ap1b1 UTSW 11 5018020 missense possibly damaging 0.83
R5249:Ap1b1 UTSW 11 5026364 missense probably damaging 0.97
R6014:Ap1b1 UTSW 11 5019364 missense possibly damaging 0.55
R6268:Ap1b1 UTSW 11 5019493 missense probably damaging 1.00
R6388:Ap1b1 UTSW 11 5026319 missense probably damaging 1.00
R6765:Ap1b1 UTSW 11 5019427 missense probably damaging 1.00
R6913:Ap1b1 UTSW 11 5012972 missense possibly damaging 0.84
R7012:Ap1b1 UTSW 11 5030963 missense probably damaging 1.00
R7107:Ap1b1 UTSW 11 5039558 missense probably benign 0.02
X0018:Ap1b1 UTSW 11 5009581 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGGTTTGAAAGCCAACTTTTG -3'
(R):5'- TGGCAGGCTCTTATGTACCAC -3'

Sequencing Primer
(F):5'- CTGAGTTCAAAGTCAGTCTGGTCTAC -3'
(R):5'- ACCCTCCACAAAGGCGTTGG -3'
Posted On2015-10-21