Incidental Mutation 'R4711:Mr1'
ID353247
Institutional Source Beutler Lab
Gene Symbol Mr1
Ensembl Gene ENSMUSG00000026471
Gene Namemajor histocompatibility complex, class I-related
SynonymsH2ls, MR1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R4711 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location155127277-155146814 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 155136590 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 193 (T193A)
Ref Sequence ENSEMBL: ENSMUSP00000027744 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027744] [ENSMUST00000192410] [ENSMUST00000194612]
Predicted Effect probably benign
Transcript: ENSMUST00000027744
AA Change: T193A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000027744
Gene: ENSMUSG00000026471
AA Change: T193A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:MHC_I 19 194 1.8e-59 PFAM
Pfam:MHC_I_3 46 193 3.9e-12 PFAM
IGc1 213 284 1.51e-12 SMART
transmembrane domain 297 319 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191773
Predicted Effect probably benign
Transcript: ENSMUST00000192410
SMART Domains Protein: ENSMUSP00000141476
Gene: ENSMUSG00000026471

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:MHC_I 19 87 8e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194612
SMART Domains Protein: ENSMUSP00000142195
Gene: ENSMUSG00000026471

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
PDB:4NQE|C 19 44 3e-7 PDB
SCOP:d1de4a2 19 44 3e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195579
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MAIT (mucosal-associated invariant T-cells) lymphocytes represent a small population of T-cells primarily found in the gut. The protein encoded by this gene is an antigen-presenting molecule that presents metabolites of microbial vitamin B to MAITs. This presentation may activate the MAITs to regulate the amounts of specific types of bacteria in the gut. Several transcript variants encoding different isoforms have been found for this gene, and a pseudogene of it has been detected about 36 kbp upstream on the same chromosome. [provided by RefSeq, Jul 2015]
PHENOTYPE: Null homozyogtes lack mucosal-associated invariant T cells that express the canonical mVa19-Ja33 rearrangement of the Tcra gene. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atg14 G A 14: 47,545,841 R346C probably damaging Het
BC005561 T C 5: 104,519,661 V683A probably damaging Het
BC037034 T C 5: 138,262,905 probably benign Het
Bin3 A G 14: 70,128,839 probably null Het
Ccser1 A G 6: 61,311,926 N358D possibly damaging Het
Col20a1 G C 2: 180,992,491 G83A probably damaging Het
Copa T G 1: 172,119,988 F1124V probably damaging Het
Cyp2c66 G A 19: 39,163,399 R186H possibly damaging Het
Dmxl2 G A 9: 54,450,924 T323M probably benign Het
Dner T C 1: 84,383,897 I664V possibly damaging Het
Erp29 A G 5: 121,445,230 I211T possibly damaging Het
Exd1 A G 2: 119,538,751 S128P possibly damaging Het
Gm8394 A G 10: 85,313,803 noncoding transcript Het
Grik4 T A 9: 42,629,093 N264Y probably damaging Het
Gsdma2 T A 11: 98,649,613 S119R probably damaging Het
Hist1h2aa C T 13: 23,934,813 P118S possibly damaging Het
Ift140 T A 17: 25,094,717 probably null Het
Ino80c T C 18: 24,114,165 N59S probably benign Het
Maob T C X: 16,716,423 T400A probably benign Het
Mast4 A G 13: 103,334,119 V25A probably benign Het
Muc5b C A 7: 141,846,033 F414L unknown Het
Nat10 A T 2: 103,748,267 C197* probably null Het
Nt5c1b A G 12: 10,370,093 K11E probably damaging Het
Olfr1104 T C 2: 87,022,026 I173V probably damaging Het
Olfr175-ps1 A T 16: 58,824,706 M1K probably null Het
Pak7 A G 2: 136,087,517 I582T probably damaging Het
Pcdha12 A G 18: 37,020,923 I232V probably benign Het
Pde8b T A 13: 95,030,450 T664S probably benign Het
Pdik1l G C 4: 134,278,990 R214G probably benign Het
Prss37 C T 6: 40,515,447 V157M probably benign Het
Ring1 T C 17: 34,022,359 E261G possibly damaging Het
Sf3a3 C A 4: 124,728,181 D371E probably benign Het
Spag9 T A 11: 94,114,351 probably null Het
Spred1 T A 2: 117,175,385 S209R probably benign Het
Tas2r121 T C 6: 132,700,890 T40A probably benign Het
Tbc1d5 T C 17: 50,935,509 T187A probably damaging Het
Tenm2 C T 11: 36,300,212 V311I probably damaging Het
Tnrc6a A G 7: 123,171,078 D697G probably damaging Het
Ttn G A 2: 76,830,060 A7439V possibly damaging Het
Wdr64 T C 1: 175,799,229 I838T probably damaging Het
Wdr7 A G 18: 63,728,465 T183A probably benign Het
Other mutations in Mr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03216:Mr1 APN 1 155129289 missense possibly damaging 0.51
R0612:Mr1 UTSW 1 155137690 missense probably damaging 1.00
R1388:Mr1 UTSW 1 155132503 missense probably damaging 0.98
R1655:Mr1 UTSW 1 155132455 missense probably benign 0.05
R2157:Mr1 UTSW 1 155146630 critical splice donor site probably null
R2437:Mr1 UTSW 1 155132531 missense probably benign 0.07
R3421:Mr1 UTSW 1 155137591 missense probably damaging 1.00
R4224:Mr1 UTSW 1 155130719 missense possibly damaging 0.62
R4240:Mr1 UTSW 1 155136667 missense probably damaging 1.00
R4849:Mr1 UTSW 1 155130690 missense probably benign 0.00
R5915:Mr1 UTSW 1 155136788 missense probably damaging 1.00
R6882:Mr1 UTSW 1 155132453 missense possibly damaging 0.54
R6940:Mr1 UTSW 1 155129268 makesense probably null
Predicted Primers PCR Primer
(F):5'- CTAAGGCTTGTCAAGATGCTGC -3'
(R):5'- TCTCCAGTATGCATATGATGGAC -3'

Sequencing Primer
(F):5'- ACAGATTTCAGCACAGGG -3'
(R):5'- TGCATATGATGGACAAGATTTCATC -3'
Posted On2015-10-21