Incidental Mutation 'R4711:Dmxl2'
ID353273
Institutional Source Beutler Lab
Gene Symbol Dmxl2
Ensembl Gene ENSMUSG00000041268
Gene NameDmx-like 2
SynonymsE130119P06Rik, 6430411K14Rik
Accession Numbers

NCBI RefSeq: NM_172771.2; MGI:2444630

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4711 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location54365158-54501626 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 54450924 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 323 (T323M)
Ref Sequence ENSEMBL: ENSMUSP00000122293 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118163] [ENSMUST00000118600] [ENSMUST00000127880]
Predicted Effect probably benign
Transcript: ENSMUST00000118163
AA Change: T497M

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113705
Gene: ENSMUSG00000041268
AA Change: T497M

DomainStartEndE-ValueType
WD40 43 84 4.58e1 SMART
WD40 100 136 2.28e2 SMART
WD40 159 198 2.57e-2 SMART
WD40 221 269 1.03e-1 SMART
low complexity region 420 440 N/A INTRINSIC
WD40 741 793 1.42e2 SMART
low complexity region 861 875 N/A INTRINSIC
low complexity region 945 961 N/A INTRINSIC
WD40 985 1029 1.15e1 SMART
WD40 1236 1273 2.84e2 SMART
Pfam:Rav1p_C 1430 1903 1.5e-71 PFAM
low complexity region 1978 1993 N/A INTRINSIC
coiled coil region 2118 2146 N/A INTRINSIC
low complexity region 2189 2204 N/A INTRINSIC
low complexity region 2251 2266 N/A INTRINSIC
low complexity region 2472 2490 N/A INTRINSIC
low complexity region 2635 2649 N/A INTRINSIC
low complexity region 2744 2766 N/A INTRINSIC
WD40 2774 2809 5.73e0 SMART
WD40 2813 2852 8.88e0 SMART
WD40 2859 2901 2.67e-1 SMART
WD40 2907 2946 2.57e-2 SMART
WD40 2949 2988 3.61e-6 SMART
WD40 3001 3039 8.25e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118600
AA Change: T497M

PolyPhen 2 Score 0.369 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000113693
Gene: ENSMUSG00000041268
AA Change: T497M

DomainStartEndE-ValueType
WD40 43 84 4.58e1 SMART
WD40 100 136 2.28e2 SMART
WD40 159 198 2.57e-2 SMART
WD40 221 269 1.03e-1 SMART
low complexity region 420 440 N/A INTRINSIC
WD40 741 793 1.42e2 SMART
low complexity region 861 875 N/A INTRINSIC
low complexity region 945 961 N/A INTRINSIC
WD40 985 1029 1.15e1 SMART
WD40 1236 1273 2.84e2 SMART
low complexity region 1426 1436 N/A INTRINSIC
Pfam:Rav1p_C 1447 1903 4.2e-68 PFAM
low complexity region 1978 1993 N/A INTRINSIC
coiled coil region 2118 2146 N/A INTRINSIC
low complexity region 2189 2204 N/A INTRINSIC
low complexity region 2251 2266 N/A INTRINSIC
low complexity region 2471 2489 N/A INTRINSIC
low complexity region 2722 2744 N/A INTRINSIC
WD40 2752 2787 5.73e0 SMART
WD40 2791 2830 8.88e0 SMART
WD40 2837 2879 2.67e-1 SMART
WD40 2885 2924 2.57e-2 SMART
WD40 2927 2966 3.61e-6 SMART
WD40 2979 3017 8.25e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127880
AA Change: T323M

PolyPhen 2 Score 0.369 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000122293
Gene: ENSMUSG00000041268
AA Change: T323M

DomainStartEndE-ValueType
Pfam:WD40 1 24 7.9e-4 PFAM
WD40 47 95 1.03e-1 SMART
low complexity region 246 266 N/A INTRINSIC
WD40 567 619 1.42e2 SMART
low complexity region 687 701 N/A INTRINSIC
low complexity region 771 787 N/A INTRINSIC
WD40 811 855 1.15e1 SMART
WD40 1062 1099 2.84e2 SMART
low complexity region 1252 1262 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128865
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144736
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with 12 WD domains. Proteins with WD domains are involved in many functions including participation in signal transduction pathways. Participation of the encoded protein in regulation of the Notch signaling pathway has been demonstrated in vitro using several human cell lines (PMID:20810660). A gene encoding a similar protein is located on chromosome 5. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete prenatal lethality. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(2) Gene trapped(2)

Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atg14 G A 14: 47,545,841 R346C probably damaging Het
BC005561 T C 5: 104,519,661 V683A probably damaging Het
BC037034 T C 5: 138,262,905 probably benign Het
Bin3 A G 14: 70,128,839 probably null Het
Ccser1 A G 6: 61,311,926 N358D possibly damaging Het
Col20a1 G C 2: 180,992,491 G83A probably damaging Het
Copa T G 1: 172,119,988 F1124V probably damaging Het
Cyp2c66 G A 19: 39,163,399 R186H possibly damaging Het
Dner T C 1: 84,383,897 I664V possibly damaging Het
Erp29 A G 5: 121,445,230 I211T possibly damaging Het
Exd1 A G 2: 119,538,751 S128P possibly damaging Het
Gm8394 A G 10: 85,313,803 noncoding transcript Het
Grik4 T A 9: 42,629,093 N264Y probably damaging Het
Gsdma2 T A 11: 98,649,613 S119R probably damaging Het
Hist1h2aa C T 13: 23,934,813 P118S possibly damaging Het
Ift140 T A 17: 25,094,717 probably null Het
Ino80c T C 18: 24,114,165 N59S probably benign Het
Maob T C X: 16,716,423 T400A probably benign Het
Mast4 A G 13: 103,334,119 V25A probably benign Het
Mr1 T C 1: 155,136,590 T193A probably benign Het
Muc5b C A 7: 141,846,033 F414L unknown Het
Nat10 A T 2: 103,748,267 C197* probably null Het
Nt5c1b A G 12: 10,370,093 K11E probably damaging Het
Olfr1104 T C 2: 87,022,026 I173V probably damaging Het
Olfr175-ps1 A T 16: 58,824,706 M1K probably null Het
Pak7 A G 2: 136,087,517 I582T probably damaging Het
Pcdha12 A G 18: 37,020,923 I232V probably benign Het
Pde8b T A 13: 95,030,450 T664S probably benign Het
Pdik1l G C 4: 134,278,990 R214G probably benign Het
Prss37 C T 6: 40,515,447 V157M probably benign Het
Ring1 T C 17: 34,022,359 E261G possibly damaging Het
Sf3a3 C A 4: 124,728,181 D371E probably benign Het
Spag9 T A 11: 94,114,351 probably null Het
Spred1 T A 2: 117,175,385 S209R probably benign Het
Tas2r121 T C 6: 132,700,890 T40A probably benign Het
Tbc1d5 T C 17: 50,935,509 T187A probably damaging Het
Tenm2 C T 11: 36,300,212 V311I probably damaging Het
Tnrc6a A G 7: 123,171,078 D697G probably damaging Het
Ttn G A 2: 76,830,060 A7439V possibly damaging Het
Wdr64 T C 1: 175,799,229 I838T probably damaging Het
Wdr7 A G 18: 63,728,465 T183A probably benign Het
Other mutations in Dmxl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Dmxl2 APN 9 54401704 missense probably benign
IGL00226:Dmxl2 APN 9 54415993 missense probably damaging 1.00
IGL00419:Dmxl2 APN 9 54406667 missense probably damaging 0.96
IGL00551:Dmxl2 APN 9 54450838 missense probably damaging 1.00
IGL00765:Dmxl2 APN 9 54415422 unclassified probably benign
IGL00852:Dmxl2 APN 9 54423313 nonsense probably null
IGL00857:Dmxl2 APN 9 54376320 missense probably benign 0.32
IGL00952:Dmxl2 APN 9 54416882 missense probably damaging 0.99
IGL01139:Dmxl2 APN 9 54458964 missense probably damaging 1.00
IGL01346:Dmxl2 APN 9 54415475 missense probably damaging 1.00
IGL01538:Dmxl2 APN 9 54445376 splice site probably benign
IGL01645:Dmxl2 APN 9 54378733 missense possibly damaging 0.93
IGL02096:Dmxl2 APN 9 54401065 missense possibly damaging 0.89
IGL02104:Dmxl2 APN 9 54404015 nonsense probably null
IGL02145:Dmxl2 APN 9 54374697 missense probably benign 0.29
IGL02210:Dmxl2 APN 9 54404049 missense probably damaging 1.00
IGL02238:Dmxl2 APN 9 54445433 missense probably damaging 1.00
IGL02255:Dmxl2 APN 9 54393768 missense probably benign 0.06
IGL02364:Dmxl2 APN 9 54393843 missense probably benign 0.02
IGL02423:Dmxl2 APN 9 54393748 missense possibly damaging 0.89
IGL02440:Dmxl2 APN 9 54406615 missense probably damaging 0.98
IGL02546:Dmxl2 APN 9 54366414 utr 3 prime probably benign
IGL02668:Dmxl2 APN 9 54416945 missense probably damaging 1.00
IGL03229:Dmxl2 APN 9 54404172 missense probably damaging 1.00
IGL03244:Dmxl2 APN 9 54416371 missense probably damaging 1.00
IGL03277:Dmxl2 APN 9 54404220 missense probably damaging 1.00
IGL03399:Dmxl2 APN 9 54446672 missense probably damaging 1.00
I2288:Dmxl2 UTSW 9 54401793 missense probably damaging 1.00
P0014:Dmxl2 UTSW 9 54401764 missense probably damaging 1.00
R0411:Dmxl2 UTSW 9 54378939 missense probably damaging 1.00
R0422:Dmxl2 UTSW 9 54399940 critical splice donor site probably null
R0432:Dmxl2 UTSW 9 54416951 missense probably benign 0.01
R0436:Dmxl2 UTSW 9 54383750 missense probably damaging 1.00
R0538:Dmxl2 UTSW 9 54393836 missense probably benign 0.06
R0603:Dmxl2 UTSW 9 54405906 missense possibly damaging 0.95
R0605:Dmxl2 UTSW 9 54419945 missense probably benign 0.01
R0625:Dmxl2 UTSW 9 54382702 missense probably benign
R0626:Dmxl2 UTSW 9 54416554 missense probably damaging 1.00
R0736:Dmxl2 UTSW 9 54378817 missense probably damaging 0.99
R0847:Dmxl2 UTSW 9 54405828 missense probably damaging 1.00
R0855:Dmxl2 UTSW 9 54366440 missense probably benign 0.03
R0962:Dmxl2 UTSW 9 54446412 missense probably damaging 0.99
R1015:Dmxl2 UTSW 9 54367765 missense probably benign 0.32
R1084:Dmxl2 UTSW 9 54416433 missense probably damaging 1.00
R1328:Dmxl2 UTSW 9 54396249 missense probably benign 0.12
R1401:Dmxl2 UTSW 9 54415428 critical splice donor site probably null
R1503:Dmxl2 UTSW 9 54446988 nonsense probably null
R1609:Dmxl2 UTSW 9 54409263 missense possibly damaging 0.90
R1613:Dmxl2 UTSW 9 54382027 missense probably benign
R1660:Dmxl2 UTSW 9 54451030 missense possibly damaging 0.68
R1712:Dmxl2 UTSW 9 54401485 missense probably benign 0.00
R1772:Dmxl2 UTSW 9 54423224 splice site probably benign
R1832:Dmxl2 UTSW 9 54460949 missense probably damaging 0.97
R1922:Dmxl2 UTSW 9 54401523 missense probably benign
R2104:Dmxl2 UTSW 9 54415564 missense probably damaging 1.00
R2109:Dmxl2 UTSW 9 54393813 missense probably benign 0.06
R2145:Dmxl2 UTSW 9 54415910 missense probably damaging 1.00
R2199:Dmxl2 UTSW 9 54376243 missense probably benign 0.35
R2352:Dmxl2 UTSW 9 54393862 missense probably damaging 1.00
R2516:Dmxl2 UTSW 9 54400094 missense probably damaging 1.00
R2981:Dmxl2 UTSW 9 54393702 missense probably damaging 1.00
R3430:Dmxl2 UTSW 9 54477461 missense possibly damaging 0.94
R3625:Dmxl2 UTSW 9 54393643 missense probably benign 0.23
R3725:Dmxl2 UTSW 9 54393769 missense probably damaging 1.00
R3787:Dmxl2 UTSW 9 54369878 missense probably damaging 1.00
R4002:Dmxl2 UTSW 9 54473832 splice site probably benign
R4004:Dmxl2 UTSW 9 54446390 missense probably benign 0.04
R4005:Dmxl2 UTSW 9 54446390 missense probably benign 0.04
R4012:Dmxl2 UTSW 9 54379013 splice site probably null
R4014:Dmxl2 UTSW 9 54378709 splice site probably null
R4115:Dmxl2 UTSW 9 54446988 nonsense probably null
R4232:Dmxl2 UTSW 9 54419909 missense possibly damaging 0.89
R4388:Dmxl2 UTSW 9 54396267 missense probably damaging 1.00
R4513:Dmxl2 UTSW 9 54419884 missense probably null 0.17
R4552:Dmxl2 UTSW 9 54451763 missense probably damaging 1.00
R4609:Dmxl2 UTSW 9 54446512 missense probably damaging 1.00
R4625:Dmxl2 UTSW 9 54404120 missense possibly damaging 0.55
R4694:Dmxl2 UTSW 9 54446905 missense probably benign 0.04
R4715:Dmxl2 UTSW 9 54446405 unclassified probably null
R4746:Dmxl2 UTSW 9 54451796 missense probably benign 0.04
R4789:Dmxl2 UTSW 9 54379815 missense probably benign 0.30
R4825:Dmxl2 UTSW 9 54404041 missense probably benign 0.01
R4911:Dmxl2 UTSW 9 54411653 missense probably damaging 1.00
R4995:Dmxl2 UTSW 9 54501441 utr 5 prime probably benign
R5026:Dmxl2 UTSW 9 54416676 missense probably damaging 1.00
R5118:Dmxl2 UTSW 9 54460987 missense probably damaging 1.00
R5174:Dmxl2 UTSW 9 54445484 unclassified probably null
R5288:Dmxl2 UTSW 9 54378757 missense probably benign
R5373:Dmxl2 UTSW 9 54369189 intron probably benign
R5374:Dmxl2 UTSW 9 54369189 intron probably benign
R5385:Dmxl2 UTSW 9 54378757 missense probably benign
R5386:Dmxl2 UTSW 9 54378757 missense probably benign
R5418:Dmxl2 UTSW 9 54374651 critical splice donor site probably null
R5540:Dmxl2 UTSW 9 54393857 missense probably benign 0.21
R5568:Dmxl2 UTSW 9 54423359 splice site probably null
R5733:Dmxl2 UTSW 9 54376266 missense possibly damaging 0.64
R5758:Dmxl2 UTSW 9 54472964 missense probably benign 0.28
R5759:Dmxl2 UTSW 9 54375508 missense probably damaging 1.00
R5893:Dmxl2 UTSW 9 54387420 missense possibly damaging 0.64
R6030:Dmxl2 UTSW 9 54393673 missense probably benign 0.18
R6030:Dmxl2 UTSW 9 54393673 missense probably benign 0.18
R6041:Dmxl2 UTSW 9 54416753 missense probably damaging 1.00
R6174:Dmxl2 UTSW 9 54393727 missense probably damaging 1.00
R6278:Dmxl2 UTSW 9 54415762 missense probably damaging 1.00
R6307:Dmxl2 UTSW 9 54382706 missense possibly damaging 0.68
R6349:Dmxl2 UTSW 9 54419909 missense possibly damaging 0.89
R6404:Dmxl2 UTSW 9 54375536 missense probably damaging 1.00
R6516:Dmxl2 UTSW 9 54416676 missense probably damaging 1.00
R6712:Dmxl2 UTSW 9 54411624 missense probably damaging 1.00
R6747:Dmxl2 UTSW 9 54416088 missense probably damaging 1.00
R6769:Dmxl2 UTSW 9 54416524 missense probably damaging 1.00
R6771:Dmxl2 UTSW 9 54416524 missense probably damaging 1.00
R6800:Dmxl2 UTSW 9 54409183 missense probably damaging 1.00
R6891:Dmxl2 UTSW 9 54480380 missense probably damaging 0.99
R6920:Dmxl2 UTSW 9 54472212 missense probably damaging 1.00
R6979:Dmxl2 UTSW 9 54450879 missense possibly damaging 0.49
R7147:Dmxl2 UTSW 9 54416729 missense probably benign 0.06
X0064:Dmxl2 UTSW 9 54401713 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGTCCTATGAAGGCTCTATGTC -3'
(R):5'- GGACAAGAAAATACATTTGCTGACC -3'

Sequencing Primer
(F):5'- CCCTGTGTAGGTGAATGCCAG -3'
(R):5'- CATTTGCTGACCATAAATTGTAAAGG -3'
Posted On2015-10-21