Incidental Mutation 'R4712:Prmt1'
ID353311
Institutional Source Beutler Lab
Gene Symbol Prmt1
Ensembl Gene ENSMUSG00000109324
Gene Nameprotein arginine N-methyltransferase 1
SynonymsHrmt1l2
MMRRC Submission 041981-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.161) question?
Stock #R4712 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location44975989-44986568 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 44981636 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 99 (S99R)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045325] [ENSMUST00000107843] [ENSMUST00000207370] [ENSMUST00000207522] [ENSMUST00000207659] [ENSMUST00000208312] [ENSMUST00000208829] [ENSMUST00000208938] [ENSMUST00000209124]
Predicted Effect probably damaging
Transcript: ENSMUST00000045325
AA Change: S68R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000045365
Gene: ENSMUSG00000109324
AA Change: S68R

DomainStartEndE-ValueType
Pfam:PRMT5 41 343 3.9e-11 PFAM
Pfam:Met_10 72 184 5.4e-7 PFAM
Pfam:MTS 78 162 7e-7 PFAM
Pfam:PrmA 79 182 8.1e-10 PFAM
Pfam:Methyltransf_31 86 226 4.1e-10 PFAM
Pfam:Methyltransf_18 88 195 3.5e-9 PFAM
Pfam:Methyltransf_26 89 189 1.4e-8 PFAM
Pfam:Methyltransf_11 93 192 3.8e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000085387
AA Change: S103R

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000082505
Gene: ENSMUSG00000052429
AA Change: S103R

DomainStartEndE-ValueType
Pfam:MTS 60 144 2e-6 PFAM
Pfam:PrmA 61 144 2.8e-8 PFAM
Pfam:Methyltransf_31 68 181 1.9e-8 PFAM
Pfam:Methyltransf_18 70 181 1.4e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107840
AA Change: S68R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000103471
Gene: ENSMUSG00000052429
AA Change: S68R

DomainStartEndE-ValueType
Pfam:PRMT5 5 290 1.2e-11 PFAM
Pfam:Met_10 19 131 4.2e-7 PFAM
Pfam:MTS 25 109 5.6e-7 PFAM
Pfam:PrmA 26 130 6.4e-10 PFAM
Pfam:Methyltransf_31 33 175 3.1e-10 PFAM
Pfam:Methyltransf_18 35 142 2.7e-9 PFAM
Pfam:Methyltransf_26 36 137 1.1e-8 PFAM
Pfam:Methyltransf_11 40 139 3e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107843
AA Change: S121R

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000103474
Gene: ENSMUSG00000109324
AA Change: S121R

DomainStartEndE-ValueType
Pfam:PRMT5 41 343 1.9e-8 PFAM
Pfam:MTS 78 162 1.1e-6 PFAM
Pfam:PrmA 79 181 1.3e-9 PFAM
Pfam:Methyltransf_31 86 226 4e-10 PFAM
Pfam:Methyltransf_18 88 192 6.2e-9 PFAM
Pfam:Methyltransf_11 93 192 1e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125886
AA Change: V181E
Predicted Effect probably damaging
Transcript: ENSMUST00000207370
AA Change: S103R

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000207522
Predicted Effect possibly damaging
Transcript: ENSMUST00000207659
AA Change: S103R

PolyPhen 2 Score 0.550 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207702
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207735
Predicted Effect probably damaging
Transcript: ENSMUST00000208312
AA Change: S103R

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000208778
Predicted Effect probably benign
Transcript: ENSMUST00000208829
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208897
Predicted Effect probably benign
Transcript: ENSMUST00000208938
AA Change: S79R

PolyPhen 2 Score 0.239 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably damaging
Transcript: ENSMUST00000209056
AA Change: S99R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000209124
Meta Mutation Damage Score 0.134 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the protein arginine N-methyltransferase (PRMT) family. Post-translational modification of target proteins by PRMTs plays an important regulatory role in many biological processes, whereby PRMTs methylate arginine residues by transferring methyl groups from S-adenosyl-L-methionine to terminal guanidino nitrogen atoms. The encoded protein is a type I PRMT and is responsible for the majority of cellular arginine methylation activity. Increased expression of this gene may play a role in many types of cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 5. [provided by RefSeq, Dec 2011]
PHENOTYPE: Embryos homozygous for a null mutation die before E6.5 and exhibit abnormal embryonic tissue morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik G A 13: 58,381,803 R332C probably benign Het
2900055J20Rik G T 18: 40,257,180 probably benign Het
A4galt G T 15: 83,227,609 N324K probably damaging Het
Ahcyl1 A G 3: 107,667,231 probably benign Het
Atrnl1 T A 19: 57,652,950 N343K probably benign Het
Batf2 C A 19: 6,171,327 Q56K probably benign Het
Cfh A T 1: 140,108,536 V691D probably damaging Het
Chst10 T C 1: 38,865,841 Y257C probably damaging Het
Dlg5 A T 14: 24,177,983 L290Q possibly damaging Het
Dnah2 T A 11: 69,516,590 T456S possibly damaging Het
Dnah6 T C 6: 73,025,012 probably null Het
Efhb T C 17: 53,451,669 K313R probably damaging Het
Eprs T A 1: 185,428,108 N1500K probably benign Het
Fbn1 T C 2: 125,341,316 T1748A probably benign Het
Gfra2 T A 14: 70,925,937 L87H probably damaging Het
Gfral T A 9: 76,193,445 Y237F possibly damaging Het
Gpr137b T C 13: 13,359,389 N361D probably benign Het
Gsdmc G T 15: 63,779,537 T272N probably benign Het
Hspe1 T A 1: 55,089,110 S21R probably benign Het
Kif21a A T 15: 90,984,755 I483N probably damaging Het
Kif4-ps T C 12: 101,146,275 noncoding transcript Het
Lpp T C 16: 24,761,657 V166A possibly damaging Het
Lrp2 A C 2: 69,506,551 D1292E probably damaging Het
Manba T C 3: 135,544,814 Y401H probably damaging Het
Msh2 T G 17: 87,678,385 probably benign Het
Myef2 A T 2: 125,088,837 probably benign Het
Ncor1 T A 11: 62,344,834 Q598L probably damaging Het
Obox3 A G 7: 15,626,839 V125A probably benign Het
Olfr124 T A 17: 37,805,700 L185* probably null Het
Olfr351 A T 2: 36,860,369 probably null Het
Olfr827 G A 10: 130,210,422 T236I possibly damaging Het
Pcdh9 C A 14: 93,888,631 L34F probably damaging Het
Pcdha3 A T 18: 36,946,507 I101F probably damaging Het
Pced1b A G 15: 97,384,794 E238G probably benign Het
Pla2r1 A T 2: 60,428,650 N1131K probably damaging Het
Rbp3 T C 14: 33,960,658 S1116P probably damaging Het
Rhobtb2 T C 14: 69,799,711 D88G probably damaging Het
Rngtt A G 4: 33,379,394 E432G probably benign Het
Sh3rf1 A G 8: 61,361,759 T451A probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Siva1 T A 12: 112,646,902 D61E probably benign Het
Skor1 A C 9: 63,139,573 probably null Het
Slc20a1 A G 2: 129,199,691 probably benign Het
Slc2a7 A G 4: 150,168,469 E522G probably benign Het
Tmprss7 A T 16: 45,690,760 I85N probably damaging Het
Tpx2 T A 2: 152,885,038 D408E probably damaging Het
Ulk4 A T 9: 121,244,370 I551N probably benign Het
Zfat A T 15: 68,110,475 probably null Het
Zfp101 C A 17: 33,394,483 probably null Het
Other mutations in Prmt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01344:Prmt1 APN 7 44977635 unclassified probably benign
IGL03195:Prmt1 APN 7 44977571 missense probably damaging 0.98
R0110:Prmt1 UTSW 7 44978801 unclassified probably benign
R0313:Prmt1 UTSW 7 44978748 missense probably benign 0.39
R0326:Prmt1 UTSW 7 44979454 missense probably damaging 1.00
R0522:Prmt1 UTSW 7 44981779 missense probably benign 0.08
R0531:Prmt1 UTSW 7 44977624 missense probably damaging 1.00
R0611:Prmt1 UTSW 7 44978801 splice site probably null
R2002:Prmt1 UTSW 7 44978724 missense probably damaging 1.00
R6032:Prmt1 UTSW 7 44977102 unclassified probably null
R6153:Prmt1 UTSW 7 44981827 missense probably damaging 1.00
R7087:Prmt1 UTSW 7 44981583 splice site probably null
R7216:Prmt1 UTSW 7 44983573 missense probably benign
Predicted Primers PCR Primer
(F):5'- AACCCTAAAGTTCGAGGCCC -3'
(R):5'- TCGGCATCTCTTCAAAGACAAGG -3'

Sequencing Primer
(F):5'- TAAAGTTCGAGGCCCAACGTC -3'
(R):5'- CATCTCTTCAAAGACAAGGTGGTGC -3'
Posted On2015-10-21