Mutagenetix > Incidental Mutation

Incidental Mutation 'R4713:Reln'

353352

Institutional Source

Beutler Lab

Gene Symbol

Reln

Ensembl Gene

ENSMUSG00000042453

Gene Name

reelin

Synonyms

MMRRC Submission

041601-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.951) question?

Stock #

R4713 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

22089452-22549700 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 22357461 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 202 (I202F)

Ref Sequence

ENSEMBL: ENSMUSP00000124052 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062372] [ENSMUST00000161356]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000062372
AA Change: I202F

PolyPhen 2 Score 0.175 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000058025
Gene: ENSMUSG00000042453
AA Change: I202F

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:Reeler	40	172	6.1e-24	PFAM
internal_repeat_3	195	360	5.04e-6	PROSPERO
EGF	674	702	1.2e1	SMART
EGF_like	1033	1061	6.95e1	SMART
EGF	1412	1442	6.02e0	SMART
EGF_like	1768	1796	2.92e1	SMART
low complexity region	1939	1948	N/A	INTRINSIC
low complexity region	2062	2071	N/A	INTRINSIC
EGF	2132	2161	1.43e-1	SMART
EGF_like	2481	2509	3.43e1	SMART
EGF	2856	2884	2.2e1	SMART
EGF	3231	3260	3.46e0	SMART
low complexity region	3450	3457	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000161356
AA Change: I202F

PolyPhen 2 Score 0.175 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000124052
Gene: ENSMUSG00000042453
AA Change: I202F

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:Reeler	54	171	2.9e-10	PFAM
internal_repeat_3	195	360	5.06e-6	PROSPERO
internal_repeat_2	207	413	3.41e-11	PROSPERO
EGF	674	702	1.2e1	SMART
EGF_like	1033	1061	6.95e1	SMART
EGF	1412	1442	6.02e0	SMART
internal_repeat_2	1452	1660	3.41e-11	PROSPERO
EGF_like	1768	1796	2.92e1	SMART
low complexity region	1939	1948	N/A	INTRINSIC
low complexity region	2062	2071	N/A	INTRINSIC
EGF	2132	2161	1.43e-1	SMART
EGF_like	2481	2509	3.43e1	SMART
EGF	2856	2884	2.2e1	SMART
EGF	3231	3260	3.46e0	SMART
low complexity region	3452	3459	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162427

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162637

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.7%
20x: 94.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large secreted extracellular matrix protein thought to control cell-cell interactions critical for cell positioning and neuronal migration during brain development. This protein may be involved in schizophrenia, autism, bipolar disorder, major depression and in migration defects associated with temporal lobe epilepsy. Mutations of this gene are associated with autosomal recessive lissencephaly with cerebellar hypoplasia. Two transcript variants encoding distinct isoforms have been identified for this gene. Other transcript variants have been described but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for most spontaneous or ENU-induced mutations show impaired righting responses, ataxia, tremors, and cerebellum and hippocampus abnormalities. Some mutants show postnatal or premature death and decreased body size while others have abnormal retinas or olfactory bulbs or infertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrb3	G	T	1: 25,586,613 (GRCm39)	T360K	probably damaging	Het
AW551984	T	C	9: 39,508,449 (GRCm39)	K356E	probably benign	Het
Bpifb2	T	A	2: 153,723,113 (GRCm39)	V123E	probably damaging	Het
Cacna1a	T	G	8: 85,276,143 (GRCm39)	F532V	probably damaging	Het
Cct8	C	A	16: 87,284,576 (GRCm39)	E204*	probably null	Het
Cd163	T	A	6: 124,294,577 (GRCm39)		probably null	Het
Cep152	C	A	2: 125,429,868 (GRCm39)	A685S	possibly damaging	Het
Chdh	A	G	14: 29,758,798 (GRCm39)	D581G	probably benign	Het
Cnpy3	A	C	17: 47,058,391 (GRCm39)	Y77*	probably null	Het
Col5a3	T	C	9: 20,704,870 (GRCm39)	E762G	unknown	Het
Creb3	A	G	4: 43,563,247 (GRCm39)	T115A	probably benign	Het
Dlat	G	T	9: 50,555,781 (GRCm39)	A412E	probably benign	Het
Dnah2	T	C	11: 69,367,514 (GRCm39)	N1789S	probably damaging	Het
Dzank1	C	T	2: 144,333,724 (GRCm39)	E370K	probably benign	Het
Eif3m	A	T	2: 104,837,184 (GRCm39)		probably null	Het
Gimap8	A	T	6: 48,635,920 (GRCm39)	M562L	probably benign	Het
Gprc6a	T	A	10: 51,507,553 (GRCm39)		probably benign	Het
Gsr	T	G	8: 34,170,347 (GRCm39)		probably null	Het
Gstcd	A	G	3: 132,688,860 (GRCm39)	V630A	probably damaging	Het
Hip1r	T	C	5: 124,128,043 (GRCm39)	I116T	probably benign	Het
Hivep3	A	G	4: 119,989,000 (GRCm39)	E1817G	probably damaging	Het
Inpp5f	A	C	7: 128,265,449 (GRCm39)	T135P	probably damaging	Het
Ism2	A	G	12: 87,331,801 (GRCm39)		silent	Het
Itga11	A	G	9: 62,673,070 (GRCm39)	D784G	probably damaging	Het
Itpr2	A	G	6: 146,274,671 (GRCm39)	F837S	probably damaging	Het
Itpr2	T	C	6: 146,298,456 (GRCm39)	E10G	probably damaging	Het
Knl1	A	T	2: 118,899,618 (GRCm39)	K440*	probably null	Het
Lonp2	T	C	8: 87,439,943 (GRCm39)	S648P	probably damaging	Het
Lrba	T	C	3: 86,267,175 (GRCm39)	S1622P	probably benign	Het
Lrp2	G	T	2: 69,318,310 (GRCm39)	A2047D	probably damaging	Het
Mcm3	G	A	1: 20,873,801 (GRCm39)	T773I	probably benign	Het
Mki67	A	G	7: 135,297,198 (GRCm39)	V2612A	probably benign	Het
Mnx1	C	A	5: 29,683,129 (GRCm39)	G49W	probably damaging	Het
Muc5b	T	A	7: 141,402,816 (GRCm39)	Y673*	probably null	Het
Myo15a	A	G	11: 60,370,756 (GRCm39)	H1172R	probably benign	Het
Myo1g	T	C	11: 6,466,080 (GRCm39)	K363R	probably null	Het
Ncoa4	T	A	14: 31,898,598 (GRCm39)	C473S	probably benign	Het
Nefh	T	C	11: 4,889,656 (GRCm39)	T988A	unknown	Het
Nwd2	T	A	5: 63,961,803 (GRCm39)	D462E	probably benign	Het
Or2av9	T	C	11: 58,380,913 (GRCm39)	T223A	probably benign	Het
Pira13	G	T	7: 3,825,680 (GRCm39)	Y396*	probably null	Het
Plec	T	C	15: 76,065,267 (GRCm39)	E1466G	unknown	Het
Prl3d2	G	T	13: 27,306,379 (GRCm39)	M35I	probably benign	Het
Rhot1	T	A	11: 80,116,428 (GRCm39)	D78E	probably benign	Het
Rsph3b	T	C	17: 7,172,528 (GRCm39)		probably null	Het
Scn10a	C	T	9: 119,438,717 (GRCm39)	M1717I	probably damaging	Het
Sema6a	T	A	18: 47,382,363 (GRCm39)	H728L	possibly damaging	Het
Slc26a3	G	T	12: 31,507,079 (GRCm39)	A345S	possibly damaging	Het
Slc35d2	A	G	13: 64,247,097 (GRCm39)	V261A	possibly damaging	Het
Slc49a3	T	C	5: 108,589,945 (GRCm39)	T486A	probably damaging	Het
Ssmem1	A	G	6: 30,519,513 (GRCm39)	D66G	probably damaging	Het
Sult2a8	A	T	7: 14,159,402 (GRCm39)	N72K	probably benign	Het
Tbx10	T	C	19: 4,046,921 (GRCm39)	L108P	probably damaging	Het
Tex14	T	C	11: 87,427,691 (GRCm39)	S48P	probably damaging	Het
Tmie	A	G	9: 110,696,596 (GRCm39)	L95P	probably damaging	Het
Tom1l2	C	G	11: 60,161,259 (GRCm39)	R84P	probably damaging	Het
Trpm3	T	A	19: 22,866,799 (GRCm39)	D543E	possibly damaging	Het
Vipr2	A	C	12: 116,043,751 (GRCm39)	R49S	probably benign	Het
Vps8	A	T	16: 21,261,189 (GRCm39)	S110C	probably damaging	Het
Zfp791	T	A	8: 85,837,597 (GRCm39)	N89I	probably damaging	Het

Other mutations in Reln

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Reln	APN	5	22,244,563 (GRCm39)	missense	possibly damaging	0.57
IGL00091:Reln	APN	5	22,244,563 (GRCm39)	missense	possibly damaging	0.57
IGL00432:Reln	APN	5	22,215,125 (GRCm39)	missense	probably damaging	1.00
IGL00433:Reln	APN	5	22,250,007 (GRCm39)	missense	probably damaging	1.00
IGL00576:Reln	APN	5	22,359,948 (GRCm39)	missense	probably benign	0.01
IGL00755:Reln	APN	5	22,265,378 (GRCm39)	missense	probably damaging	0.98
IGL00777:Reln	APN	5	22,223,848 (GRCm39)	critical splice donor site	probably null
IGL00900:Reln	APN	5	22,185,115 (GRCm39)	missense	probably damaging	0.98
IGL01067:Reln	APN	5	22,184,664 (GRCm39)	missense	probably damaging	1.00
IGL01104:Reln	APN	5	22,191,965 (GRCm39)	missense	probably damaging	0.99
IGL01141:Reln	APN	5	22,174,031 (GRCm39)	missense	probably damaging	1.00
IGL01141:Reln	APN	5	22,124,067 (GRCm39)	missense	probably damaging	1.00
IGL01333:Reln	APN	5	22,376,249 (GRCm39)	missense	probably damaging	0.99
IGL01341:Reln	APN	5	22,174,077 (GRCm39)	missense	probably damaging	1.00
IGL01354:Reln	APN	5	22,124,173 (GRCm39)	nonsense	probably null
IGL01361:Reln	APN	5	22,124,019 (GRCm39)	missense	probably benign	0.06
IGL01446:Reln	APN	5	22,174,315 (GRCm39)	missense	probably damaging	0.99
IGL01448:Reln	APN	5	22,245,403 (GRCm39)	missense	probably benign	0.40
IGL01612:Reln	APN	5	22,101,928 (GRCm39)	missense	probably damaging	0.99
IGL01695:Reln	APN	5	22,125,436 (GRCm39)	missense	probably damaging	1.00
IGL01718:Reln	APN	5	22,152,512 (GRCm39)	missense	possibly damaging	0.60
IGL01749:Reln	APN	5	22,549,244 (GRCm39)	nonsense	probably null
IGL01875:Reln	APN	5	22,109,715 (GRCm39)	missense	probably benign
IGL02013:Reln	APN	5	22,155,877 (GRCm39)	missense	probably damaging	1.00
IGL02031:Reln	APN	5	22,184,014 (GRCm39)	missense	probably damaging	0.99
IGL02186:Reln	APN	5	22,114,956 (GRCm39)	missense	probably damaging	1.00
IGL02228:Reln	APN	5	22,109,729 (GRCm39)	missense	probably damaging	0.99
IGL02248:Reln	APN	5	22,115,990 (GRCm39)	missense	probably damaging	1.00
IGL02336:Reln	APN	5	22,134,132 (GRCm39)	missense	probably damaging	1.00
IGL02352:Reln	APN	5	22,244,563 (GRCm39)	missense	possibly damaging	0.57
IGL02359:Reln	APN	5	22,244,563 (GRCm39)	missense	possibly damaging	0.57
IGL02376:Reln	APN	5	22,285,789 (GRCm39)	nonsense	probably null
IGL02408:Reln	APN	5	22,106,617 (GRCm39)	missense	probably benign	0.44
IGL02415:Reln	APN	5	22,176,949 (GRCm39)	missense	possibly damaging	0.91
IGL02512:Reln	APN	5	22,245,425 (GRCm39)	missense	probably benign	0.00
IGL02540:Reln	APN	5	22,239,750 (GRCm39)	missense	probably damaging	0.96
IGL02624:Reln	APN	5	22,308,355 (GRCm39)	missense	probably benign	0.09
IGL02720:Reln	APN	5	22,202,939 (GRCm39)	missense	probably damaging	0.99
IGL02894:Reln	APN	5	22,090,546 (GRCm39)	missense	possibly damaging	0.72
IGL02999:Reln	APN	5	22,200,363 (GRCm39)	missense	probably damaging	1.00
IGL03125:Reln	APN	5	22,115,842 (GRCm39)	missense	probably damaging	1.00
IGL03298:Reln	APN	5	22,115,834 (GRCm39)	missense	probably damaging	0.99
Fishing	UTSW	5	22,101,839 (GRCm39)	missense	probably damaging	1.00
P0020:Reln	UTSW	5	22,311,058 (GRCm39)	missense	possibly damaging	0.91
PIT4151001:Reln	UTSW	5	22,491,894 (GRCm39)	missense	possibly damaging	0.71
R0018:Reln	UTSW	5	22,130,369 (GRCm39)	missense	probably benign	0.01
R0105:Reln	UTSW	5	22,253,813 (GRCm39)	missense	probably damaging	0.99
R0105:Reln	UTSW	5	22,253,813 (GRCm39)	missense	probably damaging	0.99
R0127:Reln	UTSW	5	22,209,134 (GRCm39)	missense	probably damaging	1.00
R0135:Reln	UTSW	5	22,333,647 (GRCm39)	missense	probably damaging	0.99
R0144:Reln	UTSW	5	22,153,447 (GRCm39)	missense	probably damaging	0.97
R0240:Reln	UTSW	5	22,311,043 (GRCm39)	missense	probably benign	0.36
R0240:Reln	UTSW	5	22,311,043 (GRCm39)	missense	probably benign	0.36
R0242:Reln	UTSW	5	22,147,595 (GRCm39)	critical splice donor site	probably null
R0242:Reln	UTSW	5	22,147,595 (GRCm39)	critical splice donor site	probably null
R0266:Reln	UTSW	5	22,193,774 (GRCm39)	missense	probably damaging	1.00
R0269:Reln	UTSW	5	22,125,535 (GRCm39)	missense	probably damaging	1.00
R0280:Reln	UTSW	5	22,432,511 (GRCm39)	splice site	probably benign
R0333:Reln	UTSW	5	22,134,240 (GRCm39)	missense	probably damaging	0.97
R0357:Reln	UTSW	5	22,155,820 (GRCm39)	missense	probably damaging	1.00
R0359:Reln	UTSW	5	22,253,798 (GRCm39)	missense	probably damaging	0.98
R0506:Reln	UTSW	5	22,125,494 (GRCm39)	missense	probably damaging	0.97
R0534:Reln	UTSW	5	22,152,406 (GRCm39)	missense	probably damaging	0.99
R0535:Reln	UTSW	5	22,256,274 (GRCm39)	splice site	probably benign
R0541:Reln	UTSW	5	22,185,107 (GRCm39)	missense	possibly damaging	0.88
R0615:Reln	UTSW	5	22,215,148 (GRCm39)	missense	probably benign	0.36
R0617:Reln	UTSW	5	22,125,535 (GRCm39)	missense	probably damaging	1.00
R0634:Reln	UTSW	5	22,223,867 (GRCm39)	missense	probably damaging	1.00
R0653:Reln	UTSW	5	22,118,228 (GRCm39)	missense	probably benign	0.44
R0704:Reln	UTSW	5	22,101,809 (GRCm39)	missense	probably damaging	0.99
R0706:Reln	UTSW	5	22,101,809 (GRCm39)	missense	probably damaging	0.99
R0959:Reln	UTSW	5	22,432,626 (GRCm39)	missense	probably damaging	0.96
R1066:Reln	UTSW	5	22,239,662 (GRCm39)	missense	probably damaging	1.00
R1110:Reln	UTSW	5	22,239,773 (GRCm39)	missense	probably benign
R1163:Reln	UTSW	5	22,104,027 (GRCm39)	missense	probably benign	0.03
R1222:Reln	UTSW	5	22,191,953 (GRCm39)	missense	probably null	0.97
R1226:Reln	UTSW	5	22,115,864 (GRCm39)	missense	probably damaging	1.00
R1440:Reln	UTSW	5	22,333,600 (GRCm39)	splice site	probably benign
R1532:Reln	UTSW	5	22,239,742 (GRCm39)	missense	probably damaging	0.99
R1552:Reln	UTSW	5	22,165,376 (GRCm39)	missense	probably benign	0.01
R1565:Reln	UTSW	5	22,130,211 (GRCm39)	missense	probably benign	0.05
R1618:Reln	UTSW	5	22,265,366 (GRCm39)	missense	probably benign	0.01
R1636:Reln	UTSW	5	22,203,681 (GRCm39)	missense	probably damaging	0.99
R1664:Reln	UTSW	5	22,134,084 (GRCm39)	missense	probably damaging	1.00
R1716:Reln	UTSW	5	22,160,093 (GRCm39)	missense	probably damaging	0.98
R1759:Reln	UTSW	5	22,215,287 (GRCm39)	missense	probably damaging	0.99
R1835:Reln	UTSW	5	22,184,000 (GRCm39)	missense	probably damaging	1.00
R1907:Reln	UTSW	5	22,249,960 (GRCm39)	critical splice donor site	probably null
R1991:Reln	UTSW	5	22,174,358 (GRCm39)	missense	possibly damaging	0.56
R2046:Reln	UTSW	5	22,147,625 (GRCm39)	missense	probably benign	0.01
R2072:Reln	UTSW	5	22,124,175 (GRCm39)	missense	probably damaging	1.00
R2103:Reln	UTSW	5	22,174,358 (GRCm39)	missense	possibly damaging	0.56
R2119:Reln	UTSW	5	22,223,998 (GRCm39)	missense	probably damaging	1.00
R2120:Reln	UTSW	5	22,174,083 (GRCm39)	missense	probably damaging	1.00
R2216:Reln	UTSW	5	22,253,003 (GRCm39)	missense	probably benign	0.30
R2219:Reln	UTSW	5	22,177,045 (GRCm39)	missense	possibly damaging	0.88
R2228:Reln	UTSW	5	22,192,076 (GRCm39)	missense	possibly damaging	0.69
R2306:Reln	UTSW	5	22,101,784 (GRCm39)	missense	probably damaging	1.00
R2316:Reln	UTSW	5	22,359,954 (GRCm39)	missense	probably benign	0.00
R2321:Reln	UTSW	5	22,120,018 (GRCm39)	missense	probably damaging	0.99
R2512:Reln	UTSW	5	22,184,688 (GRCm39)	missense	possibly damaging	0.89
R2519:Reln	UTSW	5	22,549,367 (GRCm39)	missense	unknown
R2870:Reln	UTSW	5	22,254,789 (GRCm39)	missense	possibly damaging	0.95
R2870:Reln	UTSW	5	22,254,789 (GRCm39)	missense	possibly damaging	0.95
R2871:Reln	UTSW	5	22,254,789 (GRCm39)	missense	possibly damaging	0.95
R2871:Reln	UTSW	5	22,254,789 (GRCm39)	missense	possibly damaging	0.95
R2872:Reln	UTSW	5	22,254,789 (GRCm39)	missense	possibly damaging	0.95
R2872:Reln	UTSW	5	22,254,789 (GRCm39)	missense	possibly damaging	0.95
R3195:Reln	UTSW	5	22,245,418 (GRCm39)	missense	possibly damaging	0.72
R3545:Reln	UTSW	5	22,432,598 (GRCm39)	missense	possibly damaging	0.64
R3546:Reln	UTSW	5	22,432,598 (GRCm39)	missense	possibly damaging	0.64
R3547:Reln	UTSW	5	22,432,598 (GRCm39)	missense	possibly damaging	0.64
R3706:Reln	UTSW	5	22,200,587 (GRCm39)	splice site	probably benign
R3713:Reln	UTSW	5	22,109,732 (GRCm39)	missense	probably damaging	0.99
R3770:Reln	UTSW	5	22,153,564 (GRCm39)	missense	probably damaging	1.00
R3836:Reln	UTSW	5	22,116,012 (GRCm39)	missense	probably damaging	1.00
R3887:Reln	UTSW	5	22,115,847 (GRCm39)	missense	possibly damaging	0.92
R3972:Reln	UTSW	5	22,183,999 (GRCm39)	missense	probably damaging	0.99
R3975:Reln	UTSW	5	22,200,364 (GRCm39)	missense	possibly damaging	0.57
R4022:Reln	UTSW	5	22,432,628 (GRCm39)	missense	probably benign	0.45
R4044:Reln	UTSW	5	22,333,630 (GRCm39)	missense	possibly damaging	0.82
R4107:Reln	UTSW	5	22,239,582 (GRCm39)	missense	probably damaging	1.00
R4297:Reln	UTSW	5	22,125,485 (GRCm39)	missense	probably damaging	0.99
R4298:Reln	UTSW	5	22,125,485 (GRCm39)	missense	probably damaging	0.99
R4299:Reln	UTSW	5	22,125,485 (GRCm39)	missense	probably damaging	0.99
R4518:Reln	UTSW	5	22,106,741 (GRCm39)	missense	probably benign	0.44
R4615:Reln	UTSW	5	22,177,870 (GRCm39)	missense	possibly damaging	0.95
R4720:Reln	UTSW	5	22,491,894 (GRCm39)	missense	possibly damaging	0.71
R4721:Reln	UTSW	5	22,124,220 (GRCm39)	missense	probably damaging	0.99
R4771:Reln	UTSW	5	22,254,698 (GRCm39)	missense	probably damaging	1.00
R4794:Reln	UTSW	5	22,549,183 (GRCm39)	missense	probably damaging	0.98
R4840:Reln	UTSW	5	22,223,844 (GRCm39)	splice site	probably null
R4860:Reln	UTSW	5	22,106,749 (GRCm39)	missense	probably benign	0.06
R4860:Reln	UTSW	5	22,106,749 (GRCm39)	missense	probably benign	0.06
R4896:Reln	UTSW	5	22,160,236 (GRCm39)	missense	probably damaging	1.00
R4908:Reln	UTSW	5	22,184,718 (GRCm39)	missense	probably benign	0.02
R4912:Reln	UTSW	5	22,130,191 (GRCm39)	missense	probably benign	0.29
R4922:Reln	UTSW	5	22,200,585 (GRCm39)	critical splice acceptor site	probably null
R4975:Reln	UTSW	5	22,165,424 (GRCm39)	missense	probably damaging	1.00
R4976:Reln	UTSW	5	22,176,868 (GRCm39)	missense	probably benign	0.05
R5020:Reln	UTSW	5	22,239,636 (GRCm39)	missense	probably damaging	1.00
R5037:Reln	UTSW	5	22,153,510 (GRCm39)	missense	probably damaging	1.00
R5082:Reln	UTSW	5	22,101,075 (GRCm39)	missense	probably benign	0.00
R5119:Reln	UTSW	5	22,176,868 (GRCm39)	missense	probably benign	0.05
R5125:Reln	UTSW	5	22,118,239 (GRCm39)	missense	possibly damaging	0.78
R5137:Reln	UTSW	5	22,160,179 (GRCm39)	missense	probably damaging	1.00
R5152:Reln	UTSW	5	22,153,627 (GRCm39)	missense	probably damaging	1.00
R5154:Reln	UTSW	5	22,193,763 (GRCm39)	missense	probably damaging	0.99
R5259:Reln	UTSW	5	22,308,395 (GRCm39)	missense	possibly damaging	0.83
R5283:Reln	UTSW	5	22,216,161 (GRCm39)	missense	probably damaging	1.00
R5386:Reln	UTSW	5	22,244,527 (GRCm39)	missense	probably benign
R5400:Reln	UTSW	5	22,184,712 (GRCm39)	missense	probably damaging	1.00
R5478:Reln	UTSW	5	22,209,201 (GRCm39)	missense	probably benign	0.00
R5514:Reln	UTSW	5	22,176,883 (GRCm39)	missense	possibly damaging	0.93
R5529:Reln	UTSW	5	22,137,713 (GRCm39)	missense	possibly damaging	0.71
R5611:Reln	UTSW	5	22,244,663 (GRCm39)	nonsense	probably null
R5648:Reln	UTSW	5	22,203,570 (GRCm39)	missense	probably benign	0.04
R5649:Reln	UTSW	5	22,106,623 (GRCm39)	missense	probably benign	0.33
R5744:Reln	UTSW	5	22,311,081 (GRCm39)	missense	probably null	0.39
R5782:Reln	UTSW	5	22,223,054 (GRCm39)	missense	probably benign	0.01
R5815:Reln	UTSW	5	22,152,431 (GRCm39)	missense	probably damaging	0.99
R5838:Reln	UTSW	5	22,104,111 (GRCm39)	missense	probably damaging	0.97
R6162:Reln	UTSW	5	22,116,048 (GRCm39)	missense	probably damaging	1.00
R6219:Reln	UTSW	5	22,153,594 (GRCm39)	missense	probably damaging	1.00
R6259:Reln	UTSW	5	22,265,331 (GRCm39)	missense	probably damaging	0.99
R6279:Reln	UTSW	5	22,101,839 (GRCm39)	missense	probably damaging	1.00
R6299:Reln	UTSW	5	22,491,942 (GRCm39)	missense	possibly damaging	0.71
R6300:Reln	UTSW	5	22,101,839 (GRCm39)	missense	probably damaging	1.00
R6314:Reln	UTSW	5	22,357,482 (GRCm39)	nonsense	probably null
R6351:Reln	UTSW	5	22,106,661 (GRCm39)	nonsense	probably null
R6369:Reln	UTSW	5	22,256,359 (GRCm39)	missense	probably benign	0.03
R6371:Reln	UTSW	5	22,200,511 (GRCm39)	missense	probably benign
R6374:Reln	UTSW	5	22,285,712 (GRCm39)	missense	probably benign	0.06
R6425:Reln	UTSW	5	22,116,018 (GRCm39)	nonsense	probably null
R6442:Reln	UTSW	5	22,137,774 (GRCm39)	missense	probably benign
R6445:Reln	UTSW	5	22,124,212 (GRCm39)	missense	probably benign	0.05
R6554:Reln	UTSW	5	22,101,838 (GRCm39)	missense	probably damaging	1.00
R6641:Reln	UTSW	5	22,134,132 (GRCm39)	missense	probably damaging	1.00
R6768:Reln	UTSW	5	22,183,905 (GRCm39)	missense	probably damaging	0.99
R6859:Reln	UTSW	5	22,239,568 (GRCm39)	missense	probably damaging	1.00
R6896:Reln	UTSW	5	22,104,177 (GRCm39)	missense	probably benign	0.18
R6932:Reln	UTSW	5	22,190,855 (GRCm39)	missense	probably benign	0.00
R6948:Reln	UTSW	5	22,177,033 (GRCm39)	missense	probably damaging	1.00
R6959:Reln	UTSW	5	22,181,562 (GRCm39)	missense	probably damaging	1.00
R7085:Reln	UTSW	5	22,120,085 (GRCm39)	nonsense	probably null
R7091:Reln	UTSW	5	22,104,027 (GRCm39)	missense	probably null	0.08
R7135:Reln	UTSW	5	22,181,594 (GRCm39)	missense	possibly damaging	0.95
R7146:Reln	UTSW	5	22,311,095 (GRCm39)	missense	probably damaging	0.97
R7167:Reln	UTSW	5	22,147,618 (GRCm39)	missense	probably damaging	1.00
R7190:Reln	UTSW	5	22,252,945 (GRCm39)	missense	probably damaging	1.00
R7256:Reln	UTSW	5	22,183,921 (GRCm39)	missense	probably benign	0.03
R7393:Reln	UTSW	5	22,181,349 (GRCm39)	missense	probably damaging	0.99
R7399:Reln	UTSW	5	22,256,365 (GRCm39)	missense	probably damaging	0.99
R7400:Reln	UTSW	5	22,176,932 (GRCm39)	missense	probably damaging	0.99
R7426:Reln	UTSW	5	22,176,951 (GRCm39)	missense	probably damaging	1.00
R7463:Reln	UTSW	5	22,308,433 (GRCm39)	missense	probably damaging	0.98
R7470:Reln	UTSW	5	22,147,739 (GRCm39)	missense	probably damaging	0.99
R7473:Reln	UTSW	5	22,134,125 (GRCm39)	missense	probably benign	0.25
R7501:Reln	UTSW	5	22,432,636 (GRCm39)	missense	possibly damaging	0.91
R7542:Reln	UTSW	5	22,160,179 (GRCm39)	missense	probably damaging	1.00
R7544:Reln	UTSW	5	22,181,276 (GRCm39)	nonsense	probably null
R7588:Reln	UTSW	5	22,090,566 (GRCm39)	missense	probably benign	0.03
R7631:Reln	UTSW	5	22,176,933 (GRCm39)	missense	probably damaging	0.97
R7644:Reln	UTSW	5	22,183,929 (GRCm39)	missense	probably benign	0.39
R7834:Reln	UTSW	5	22,244,633 (GRCm39)	missense	possibly damaging	0.94
R7923:Reln	UTSW	5	22,339,690 (GRCm39)	missense	probably benign	0.00
R7938:Reln	UTSW	5	22,155,870 (GRCm39)	missense	probably damaging	0.97
R8006:Reln	UTSW	5	22,104,082 (GRCm39)	nonsense	probably null
R8062:Reln	UTSW	5	22,176,990 (GRCm39)	missense	probably benign	0.00
R8222:Reln	UTSW	5	22,136,475 (GRCm39)	nonsense	probably null
R8266:Reln	UTSW	5	22,223,085 (GRCm39)	missense	possibly damaging	0.62
R8267:Reln	UTSW	5	22,209,110 (GRCm39)	missense	probably damaging	1.00
R8487:Reln	UTSW	5	22,104,027 (GRCm39)	missense	probably benign	0.03
R8523:Reln	UTSW	5	22,209,229 (GRCm39)	missense	probably damaging	1.00
R8751:Reln	UTSW	5	22,147,672 (GRCm39)	missense	probably benign	0.37
R8801:Reln	UTSW	5	22,155,854 (GRCm39)	missense	possibly damaging	0.94
R8802:Reln	UTSW	5	22,130,257 (GRCm39)	missense	probably damaging	0.98
R8978:Reln	UTSW	5	22,090,512 (GRCm39)	missense	possibly damaging	0.85
R8988:Reln	UTSW	5	22,104,155 (GRCm39)	missense	probably damaging	0.97
R8995:Reln	UTSW	5	22,184,577 (GRCm39)	missense	probably benign	0.00
R9022:Reln	UTSW	5	22,181,613 (GRCm39)	missense	possibly damaging	0.66
R9042:Reln	UTSW	5	22,253,036 (GRCm39)	missense	probably damaging	1.00
R9069:Reln	UTSW	5	22,216,059 (GRCm39)	missense	probably damaging	1.00
R9089:Reln	UTSW	5	22,130,198 (GRCm39)	missense	probably benign	0.01
R9126:Reln	UTSW	5	22,160,194 (GRCm39)	missense	probably damaging	1.00
R9172:Reln	UTSW	5	22,155,815 (GRCm39)	critical splice donor site	probably null
R9182:Reln	UTSW	5	22,106,617 (GRCm39)	missense	probably benign	0.44
R9196:Reln	UTSW	5	22,357,471 (GRCm39)	missense	probably damaging	1.00
R9211:Reln	UTSW	5	22,549,200 (GRCm39)	nonsense	probably null
R9241:Reln	UTSW	5	22,174,067 (GRCm39)	missense	probably damaging	0.99
R9244:Reln	UTSW	5	22,120,151 (GRCm39)	missense	probably damaging	0.99
R9281:Reln	UTSW	5	22,153,545 (GRCm39)	missense	probably damaging	1.00
R9295:Reln	UTSW	5	22,209,209 (GRCm39)	missense	possibly damaging	0.95
R9303:Reln	UTSW	5	22,193,705 (GRCm39)	missense	possibly damaging	0.95
R9303:Reln	UTSW	5	22,285,689 (GRCm39)	missense	probably benign	0.01
R9309:Reln	UTSW	5	22,176,866 (GRCm39)	missense	probably benign	0.37
R9338:Reln	UTSW	5	22,202,937 (GRCm39)	missense	probably damaging	0.98
R9381:Reln	UTSW	5	22,549,202 (GRCm39)	missense	possibly damaging	0.93
R9430:Reln	UTSW	5	22,120,105 (GRCm39)	missense	probably damaging	1.00
R9509:Reln	UTSW	5	22,549,198 (GRCm39)	missense	possibly damaging	0.93
R9515:Reln	UTSW	5	22,125,508 (GRCm39)	missense	possibly damaging	0.46
R9717:Reln	UTSW	5	22,136,427 (GRCm39)	missense	probably benign	0.26
R9745:Reln	UTSW	5	22,152,525 (GRCm39)	missense	probably damaging	1.00
R9778:Reln	UTSW	5	22,155,943 (GRCm39)	missense	probably damaging	1.00
Z1176:Reln	UTSW	5	22,184,022 (GRCm39)	missense	probably damaging	1.00
Z1177:Reln	UTSW	5	22,209,080 (GRCm39)	missense	probably damaging	0.96
Z1177:Reln	UTSW	5	22,174,239 (GRCm39)	missense	probably damaging	0.96
Z1177:Reln	UTSW	5	22,432,634 (GRCm39)	missense	probably damaging	1.00
Z1177:Reln	UTSW	5	22,359,957 (GRCm39)	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- GTGTAGTCCGCAGTTAACCATTC -3'
(R):5'- AGCATCACCTTTGCCCTCAG -3'

Sequencing Primer
(F):5'- GTTAACCATTCCCACCAATACATTAG -3'
(R):5'- GCCCTCAGCATTAACAGAGC -3'

Posted On

2015-10-21