Incidental Mutation 'R4714:Usp40'
ID353412
Institutional Source Beutler Lab
Gene Symbol Usp40
Ensembl Gene ENSMUSG00000005501
Gene Nameubiquitin specific peptidase 40
SynonymsB230215L03Rik
MMRRC Submission 041956-MU
Accession Numbers

Genbank: NM_001033291

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4714 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location87945119-88008551 bp(-) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) C to T at 87967179 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140107 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040783] [ENSMUST00000187758] [ENSMUST00000188332]
Predicted Effect probably benign
Transcript: ENSMUST00000040783
SMART Domains Protein: ENSMUSP00000038533
Gene: ENSMUSG00000005501

DomainStartEndE-ValueType
Pfam:UCH 40 344 1.1e-31 PFAM
Pfam:UCH_1 41 320 1.2e-20 PFAM
low complexity region 641 650 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000187758
SMART Domains Protein: ENSMUSP00000140107
Gene: ENSMUSG00000005501

DomainStartEndE-ValueType
Pfam:UCH 40 346 8.7e-41 PFAM
Pfam:UCH_1 41 319 2.4e-22 PFAM
low complexity region 641 650 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188332
SMART Domains Protein: ENSMUSP00000140574
Gene: ENSMUSG00000005501

DomainStartEndE-ValueType
Pfam:UCH 40 70 5.9e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189409
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190446
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Modification of cellular proteins by ubiquitin is an essential regulatory mechanism controlled by the coordinated action of multiple ubiquitin-conjugating and deubiquitinating enzymes. USP40 belongs to a large family of cysteine proteases that function as deubiquitinating enzymes (Quesada et al., 2004 [PubMed 14715245]).[supplied by OMIM, Mar 2008]
Allele List at MGI

All alleles(4) : Targeted, other(2) Gene trapped(2)

Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4930486L24Rik A G 13: 60,844,318 V298A probably damaging Het
Abca12 A G 1: 71,321,450 V534A probably benign Het
Abcb4 A G 5: 8,930,906 probably null Het
Adam30 A T 3: 98,162,854 S668C probably damaging Het
Ap1g1 T A 8: 109,829,620 V196D probably damaging Het
Atp11b G A 3: 35,834,394 V738I probably benign Het
Cast C T 13: 74,798,715 V27I probably damaging Het
Cfap54 A G 10: 92,815,918 I3090T probably benign Het
Cgn C A 3: 94,779,438 G185W probably damaging Het
Champ1 T C 8: 13,878,063 Y74H probably damaging Het
Cpm T C 10: 117,675,985 I278T probably damaging Het
Dcaf15 T C 8: 84,102,216 T141A probably benign Het
Dcun1d1 C T 3: 35,895,670 V244M probably damaging Het
Defb8 A G 8: 19,447,559 L12P probably damaging Het
Dlg1 A T 16: 31,790,261 I225F probably damaging Het
Dync2h1 G T 9: 7,118,932 H2178N possibly damaging Het
Enam A G 5: 88,503,536 E893G probably damaging Het
Flt4 T A 11: 49,627,207 L358Q probably damaging Het
Frmpd1 A G 4: 45,284,785 Q1202R probably benign Het
Ghr T A 15: 3,320,397 D433V possibly damaging Het
Grm7 G A 6: 111,080,422 D328N possibly damaging Het
Haus4 T C 14: 54,542,120 D349G probably benign Het
Helz T C 11: 107,626,716 probably null Het
Hif3a A G 7: 17,056,271 L69P probably damaging Het
Ifit1 A G 19: 34,648,163 E233G probably damaging Het
Kcnc2 T C 10: 112,455,828 F307S possibly damaging Het
Lrp1b A T 2: 41,110,759 V2151E possibly damaging Het
Lrp5 T C 19: 3,659,454 N92S probably damaging Het
Metrnl C T 11: 121,716,013 A216V probably damaging Het
Msh2 A G 17: 87,718,789 T732A probably damaging Het
Necab2 T C 8: 119,467,595 L270P probably damaging Het
Noc3l T C 19: 38,815,713 K74E probably benign Het
Oas2 A T 5: 120,733,472 L702Q probably damaging Het
Olfr136 A C 17: 38,335,840 I228L possibly damaging Het
Olfr3 A T 2: 36,813,035 I19N probably benign Het
Olfr728 A G 14: 50,139,979 I220T possibly damaging Het
Olfr731 C A 14: 50,238,367 V173L possibly damaging Het
Olfr812 A T 10: 129,842,945 N32K probably damaging Het
Pax6 A G 2: 105,695,400 H376R possibly damaging Het
Pnkd C T 1: 74,351,782 R376C probably damaging Het
Pnpla8 T C 12: 44,295,913 F484S probably damaging Het
Psme4 T A 11: 30,832,573 H909Q probably benign Het
Rasip1 CGG CGGG 7: 45,632,396 probably null Het
Rbm47 A T 5: 66,025,052 Y413N probably damaging Het
Rnf123 A G 9: 108,052,439 probably null Het
Ruvbl1 T A 6: 88,484,430 M259K possibly damaging Het
Sohlh2 A G 3: 55,190,529 H134R probably benign Het
Sorbs2 A G 8: 45,795,293 D447G possibly damaging Het
Tank C T 2: 61,650,229 P370S probably benign Het
Tenm4 A G 7: 96,894,924 E2049G probably damaging Het
Tnik A G 3: 28,594,077 H426R possibly damaging Het
Trpm6 C A 19: 18,854,200 S1476R possibly damaging Het
Trpm7 G A 2: 126,840,783 Q389* probably null Het
Ttc28 G A 5: 111,285,229 R2043Q possibly damaging Het
Tymp A G 15: 89,376,307 S103P probably damaging Het
Vmn1r202 T A 13: 22,501,807 N147Y probably damaging Het
Vmn2r89 T C 14: 51,452,231 S64P probably damaging Het
Vps13a A T 19: 16,749,856 D229E probably benign Het
Vps52 A G 17: 33,961,179 I354V probably benign Het
Zbtb8os T C 4: 129,341,764 F90L probably damaging Het
Zfp36l1 T C 12: 80,110,496 D37G possibly damaging Het
Zfp467 A G 6: 48,427,817 S109P unknown Het
Zzef1 T A 11: 72,837,212 C535S probably damaging Het
Other mutations in Usp40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Usp40 APN 1 88004238 splice site probably benign
IGL00828:Usp40 APN 1 87978306 unclassified probably benign
IGL01090:Usp40 APN 1 87962465 missense probably benign 0.01
IGL01123:Usp40 APN 1 87986123 missense probably benign 0.01
IGL01401:Usp40 APN 1 87994198 missense probably damaging 1.00
IGL02506:Usp40 APN 1 87982016 missense probably damaging 0.98
IGL02580:Usp40 APN 1 87980966 splice site probably null
IGL02625:Usp40 APN 1 87950017 missense probably benign 0.19
IGL02811:Usp40 APN 1 87995736 missense probably damaging 1.00
IGL02958:Usp40 APN 1 87978485 missense probably damaging 0.99
G5030:Usp40 UTSW 1 87994219 missense probably damaging 1.00
R0019:Usp40 UTSW 1 87978411 missense probably benign 0.00
R0282:Usp40 UTSW 1 87980958 splice site probably benign
R0453:Usp40 UTSW 1 87946598 makesense probably null
R0646:Usp40 UTSW 1 87978522 missense probably benign 0.00
R1440:Usp40 UTSW 1 87982086 missense probably benign 0.01
R1490:Usp40 UTSW 1 87988965 nonsense probably null
R1620:Usp40 UTSW 1 87994225 missense probably damaging 1.00
R1881:Usp40 UTSW 1 87994271 missense probably benign 0.08
R1903:Usp40 UTSW 1 87982056 missense probably benign 0.15
R1912:Usp40 UTSW 1 87946646 missense probably benign 0.00
R1919:Usp40 UTSW 1 87995842 missense possibly damaging 0.75
R1976:Usp40 UTSW 1 87978536 missense probably benign 0.00
R2111:Usp40 UTSW 1 87950214 missense probably benign 0.17
R2112:Usp40 UTSW 1 87950214 missense probably benign 0.17
R2163:Usp40 UTSW 1 87995858 splice site probably benign
R2432:Usp40 UTSW 1 87982082 missense probably benign
R2865:Usp40 UTSW 1 87949979 nonsense probably null
R3885:Usp40 UTSW 1 87967269 missense probably damaging 1.00
R4360:Usp40 UTSW 1 87952361 missense probably damaging 1.00
R4370:Usp40 UTSW 1 87997875 missense probably benign
R4496:Usp40 UTSW 1 87995737 missense possibly damaging 0.69
R4888:Usp40 UTSW 1 87986201 critical splice acceptor site probably null
R4944:Usp40 UTSW 1 87952355 missense probably benign 0.10
R5269:Usp40 UTSW 1 87995782 missense probably benign 0.01
R5629:Usp40 UTSW 1 87981009 missense probably benign
R5696:Usp40 UTSW 1 87995752 missense probably benign 0.27
R5756:Usp40 UTSW 1 87951691 missense possibly damaging 0.66
R5887:Usp40 UTSW 1 87999870 missense probably damaging 1.00
R5910:Usp40 UTSW 1 87968400 nonsense probably null
R6014:Usp40 UTSW 1 87980016 missense probably damaging 1.00
R6044:Usp40 UTSW 1 87990150 missense probably benign
R6083:Usp40 UTSW 1 87978559 missense probably benign 0.01
R6299:Usp40 UTSW 1 87997927 missense probably damaging 0.99
R6625:Usp40 UTSW 1 87967213 missense probably benign 0.01
R6757:Usp40 UTSW 1 87980037 missense probably damaging 0.99
R6810:Usp40 UTSW 1 87981033 missense probably benign 0.11
R7110:Usp40 UTSW 1 87986162 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- AGCTCACATTTCTGTAGCATTATCG -3'
(R):5'- CAGAGTTGCTCCTTCCCAAC -3'

Sequencing Primer
(F):5'- GTAGCATTATCGATCATCAGAAAAGC -3'
(R):5'- ACCATTCCAAAGCATATTTCTTAGG -3'
Posted On2015-10-21