Incidental Mutation 'R4714:Psme4'
ID353456
Institutional Source Beutler Lab
Gene Symbol Psme4
Ensembl Gene ENSMUSG00000040850
Gene Nameproteasome (prosome, macropain) activator subunit 4
Synonyms
MMRRC Submission 041956-MU
Accession Numbers

Genbank: NM_134013

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4714 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location30771726-30880361 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 30832573 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 909 (H909Q)
Ref Sequence ENSEMBL: ENSMUSP00000045460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041231]
Predicted Effect probably benign
Transcript: ENSMUST00000041231
AA Change: H909Q

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000045460
Gene: ENSMUSG00000040850
AA Change: H909Q

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
low complexity region 122 133 N/A INTRINSIC
Pfam:BLM10_mid 330 828 8.8e-119 PFAM
SCOP:d1b3ua_ 1183 1716 3e-14 SMART
Pfam:DUF3437 1756 1843 5.3e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142217
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150219
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele show normal repair of DNA double-strand breaks but exhibit significantly reduced male fertility due to defects in spermatogenesis observed in both meiotic spermatocytes and postmeiotic haploid spermatids. [provided by MGI curators]
Allele List at MGI

All alleles(25) : Targeted, knock-out(1) Gene trapped(24)

Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
4930486L24Rik A G 13: 60,844,318 V298A probably damaging Het
Abca12 A G 1: 71,321,450 V534A probably benign Het
Abcb4 A G 5: 8,930,906 probably null Het
Adam30 A T 3: 98,162,854 S668C probably damaging Het
Ap1g1 T A 8: 109,829,620 V196D probably damaging Het
Atp11b G A 3: 35,834,394 V738I probably benign Het
Cast C T 13: 74,798,715 V27I probably damaging Het
Cfap54 A G 10: 92,815,918 I3090T probably benign Het
Cgn C A 3: 94,779,438 G185W probably damaging Het
Champ1 T C 8: 13,878,063 Y74H probably damaging Het
Cpm T C 10: 117,675,985 I278T probably damaging Het
Dcaf15 T C 8: 84,102,216 T141A probably benign Het
Dcun1d1 C T 3: 35,895,670 V244M probably damaging Het
Defb8 A G 8: 19,447,559 L12P probably damaging Het
Dlg1 A T 16: 31,790,261 I225F probably damaging Het
Dync2h1 G T 9: 7,118,932 H2178N possibly damaging Het
Enam A G 5: 88,503,536 E893G probably damaging Het
Flt4 T A 11: 49,627,207 L358Q probably damaging Het
Frmpd1 A G 4: 45,284,785 Q1202R probably benign Het
Ghr T A 15: 3,320,397 D433V possibly damaging Het
Grm7 G A 6: 111,080,422 D328N possibly damaging Het
Haus4 T C 14: 54,542,120 D349G probably benign Het
Helz T C 11: 107,626,716 probably null Het
Hif3a A G 7: 17,056,271 L69P probably damaging Het
Ifit1 A G 19: 34,648,163 E233G probably damaging Het
Kcnc2 T C 10: 112,455,828 F307S possibly damaging Het
Lrp1b A T 2: 41,110,759 V2151E possibly damaging Het
Lrp5 T C 19: 3,659,454 N92S probably damaging Het
Metrnl C T 11: 121,716,013 A216V probably damaging Het
Msh2 A G 17: 87,718,789 T732A probably damaging Het
Necab2 T C 8: 119,467,595 L270P probably damaging Het
Noc3l T C 19: 38,815,713 K74E probably benign Het
Oas2 A T 5: 120,733,472 L702Q probably damaging Het
Olfr136 A C 17: 38,335,840 I228L possibly damaging Het
Olfr3 A T 2: 36,813,035 I19N probably benign Het
Olfr728 A G 14: 50,139,979 I220T possibly damaging Het
Olfr731 C A 14: 50,238,367 V173L possibly damaging Het
Olfr812 A T 10: 129,842,945 N32K probably damaging Het
Pax6 A G 2: 105,695,400 H376R possibly damaging Het
Pnkd C T 1: 74,351,782 R376C probably damaging Het
Pnpla8 T C 12: 44,295,913 F484S probably damaging Het
Rasip1 CGG CGGG 7: 45,632,396 probably null Het
Rbm47 A T 5: 66,025,052 Y413N probably damaging Het
Rnf123 A G 9: 108,052,439 probably null Het
Ruvbl1 T A 6: 88,484,430 M259K possibly damaging Het
Sohlh2 A G 3: 55,190,529 H134R probably benign Het
Sorbs2 A G 8: 45,795,293 D447G possibly damaging Het
Tank C T 2: 61,650,229 P370S probably benign Het
Tenm4 A G 7: 96,894,924 E2049G probably damaging Het
Tnik A G 3: 28,594,077 H426R possibly damaging Het
Trpm6 C A 19: 18,854,200 S1476R possibly damaging Het
Trpm7 G A 2: 126,840,783 Q389* probably null Het
Ttc28 G A 5: 111,285,229 R2043Q possibly damaging Het
Tymp A G 15: 89,376,307 S103P probably damaging Het
Usp40 C T 1: 87,967,179 probably null Het
Vmn1r202 T A 13: 22,501,807 N147Y probably damaging Het
Vmn2r89 T C 14: 51,452,231 S64P probably damaging Het
Vps13a A T 19: 16,749,856 D229E probably benign Het
Vps52 A G 17: 33,961,179 I354V probably benign Het
Zbtb8os T C 4: 129,341,764 F90L probably damaging Het
Zfp36l1 T C 12: 80,110,496 D37G possibly damaging Het
Zfp467 A G 6: 48,427,817 S109P unknown Het
Zzef1 T A 11: 72,837,212 C535S probably damaging Het
Other mutations in Psme4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Psme4 APN 11 30815710 critical splice donor site probably null
IGL00401:Psme4 APN 11 30821079 splice site probably benign
IGL00475:Psme4 APN 11 30845252 missense probably benign 0.14
IGL00576:Psme4 APN 11 30823145 missense possibly damaging 0.50
IGL00817:Psme4 APN 11 30820129 missense probably benign 0.01
IGL01525:Psme4 APN 11 30809936 splice site probably benign
IGL01862:Psme4 APN 11 30812038 nonsense probably null
IGL02310:Psme4 APN 11 30837484 missense probably benign 0.06
IGL02477:Psme4 APN 11 30842083 missense probably damaging 0.99
IGL02545:Psme4 APN 11 30841586 missense possibly damaging 0.81
IGL02608:Psme4 APN 11 30820944 missense probably benign 0.34
IGL02621:Psme4 APN 11 30848131 missense probably benign
IGL02822:Psme4 APN 11 30848204 unclassified probably benign
IGL02833:Psme4 APN 11 30850715 unclassified probably benign
IGL02964:Psme4 APN 11 30791095 nonsense probably null
IGL03273:Psme4 APN 11 30848130 missense probably damaging 1.00
IGL03348:Psme4 APN 11 30876796 missense probably damaging 1.00
IGL03382:Psme4 APN 11 30807788 missense possibly damaging 0.94
H2330:Psme4 UTSW 11 30851210 missense probably benign 0.17
PIT4378001:Psme4 UTSW 11 30821079 splice site probably benign
R0276:Psme4 UTSW 11 30811980 missense probably damaging 1.00
R0462:Psme4 UTSW 11 30848117 missense probably damaging 1.00
R0685:Psme4 UTSW 11 30878415 missense probably damaging 1.00
R0766:Psme4 UTSW 11 30807687 intron probably null
R0830:Psme4 UTSW 11 30807797 missense possibly damaging 0.53
R0940:Psme4 UTSW 11 30815264 missense possibly damaging 0.53
R1018:Psme4 UTSW 11 30804310 missense probably damaging 1.00
R1312:Psme4 UTSW 11 30807687 intron probably null
R1448:Psme4 UTSW 11 30852744 missense probably damaging 1.00
R1713:Psme4 UTSW 11 30806310 missense probably damaging 1.00
R1732:Psme4 UTSW 11 30848105 missense probably benign 0.03
R1813:Psme4 UTSW 11 30804353 missense probably benign 0.14
R1905:Psme4 UTSW 11 30810922 missense probably damaging 1.00
R1907:Psme4 UTSW 11 30810922 missense probably damaging 1.00
R1911:Psme4 UTSW 11 30815658 missense probably benign 0.02
R1956:Psme4 UTSW 11 30832424 missense probably damaging 0.99
R1974:Psme4 UTSW 11 30819011 missense probably benign 0.00
R1980:Psme4 UTSW 11 30832615 missense possibly damaging 0.84
R1986:Psme4 UTSW 11 30830352 missense probably benign 0.01
R2046:Psme4 UTSW 11 30817723 splice site probably benign
R2142:Psme4 UTSW 11 30820998 missense possibly damaging 0.89
R2698:Psme4 UTSW 11 30874282 critical splice donor site probably null
R2844:Psme4 UTSW 11 30845173 splice site probably benign
R3807:Psme4 UTSW 11 30856027 splice site probably null
R3876:Psme4 UTSW 11 30856068 missense probably damaging 0.99
R4420:Psme4 UTSW 11 30812028 missense possibly damaging 0.67
R4584:Psme4 UTSW 11 30834318 missense probably damaging 1.00
R4615:Psme4 UTSW 11 30834287 missense probably benign 0.02
R5008:Psme4 UTSW 11 30856896 intron probably benign
R5109:Psme4 UTSW 11 30791095 nonsense probably null
R5155:Psme4 UTSW 11 30876806 missense probably damaging 1.00
R5199:Psme4 UTSW 11 30853272 missense probably benign 0.00
R5205:Psme4 UTSW 11 30832666 intron probably benign
R5452:Psme4 UTSW 11 30791168 missense probably benign
R5491:Psme4 UTSW 11 30815246 missense possibly damaging 0.63
R5685:Psme4 UTSW 11 30809837 missense probably damaging 0.99
R5764:Psme4 UTSW 11 30772364 intron probably benign
R5853:Psme4 UTSW 11 30791234 critical splice donor site probably null
R5865:Psme4 UTSW 11 30791993 missense possibly damaging 0.95
R5903:Psme4 UTSW 11 30841589 missense probably benign 0.28
R5927:Psme4 UTSW 11 30804294 missense possibly damaging 0.82
R6004:Psme4 UTSW 11 30856896 intron probably benign
R6102:Psme4 UTSW 11 30865567 missense probably damaging 1.00
R6247:Psme4 UTSW 11 30853245 missense possibly damaging 0.60
R6527:Psme4 UTSW 11 30832175 missense probably benign
R6750:Psme4 UTSW 11 30853203 missense probably damaging 1.00
R6885:Psme4 UTSW 11 30834307 nonsense probably null
R6939:Psme4 UTSW 11 30837291 missense probably damaging 0.99
R6945:Psme4 UTSW 11 30837437 missense probably benign 0.06
R7029:Psme4 UTSW 11 30772474 intron probably benign
R7049:Psme4 UTSW 11 30813904 intron probably null
R7098:Psme4 UTSW 11 30850661 missense probably damaging 0.99
R7107:Psme4 UTSW 11 30848105 missense probably benign 0.03
R7223:Psme4 UTSW 11 30874226 missense probably benign 0.33
R7319:Psme4 UTSW 11 30807790 missense probably benign 0.00
R7410:Psme4 UTSW 11 30815279 nonsense probably null
R7469:Psme4 UTSW 11 30802837 missense probably benign 0.20
V5088:Psme4 UTSW 11 30851210 missense probably benign 0.17
X0063:Psme4 UTSW 11 30832600 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- AAACAGCAGGTTGGGGTTTATATAG -3'
(R):5'- TTCTTAAAGCTACTACTTACAGGGC -3'

Sequencing Primer
(F):5'- GGCCACATACTTGATAATTCAGAAG -3'
(R):5'- GCTACTACTTACAGGGCAAACTTTC -3'
Posted On2015-10-21