Incidental Mutation 'R4684:Htt'
ID353503
Institutional Source Beutler Lab
Gene Symbol Htt
Ensembl Gene ENSMUSG00000029104
Gene Namehuntingtin
SynonymsHD, Hdh, htt, huntingtin, IT15
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4684 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location34761740-34912534 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 34852765 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 1521 (P1521S)
Ref Sequence ENSEMBL: ENSMUSP00000078945 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080036]
Predicted Effect probably damaging
Transcript: ENSMUST00000080036
AA Change: P1521S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000078945
Gene: ENSMUSG00000029104
AA Change: P1521S

DomainStartEndE-ValueType
low complexity region 18 65 N/A INTRINSIC
SCOP:d1qgra_ 92 370 1e-12 SMART
low complexity region 371 388 N/A INTRINSIC
low complexity region 432 453 N/A INTRINSIC
low complexity region 1150 1161 N/A INTRINSIC
low complexity region 1423 1441 N/A INTRINSIC
Pfam:DUF3652 1494 1534 9.3e-20 PFAM
low complexity region 1812 1822 N/A INTRINSIC
Blast:GAF 1866 2040 1e-104 BLAST
low complexity region 2461 2472 N/A INTRINSIC
low complexity region 2611 2621 N/A INTRINSIC
low complexity region 2622 2635 N/A INTRINSIC
low complexity region 2857 2872 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Huntingtin is a disease gene linked to Huntington's disease, a neurodegenerative disorder characterized by loss of striatal neurons. This is thought to be caused by an expanded, unstable trinucleotide repeat in the huntingtin gene, which translates as a polyglutamine repeat in the protein product. A fairly broad range of trinucleotide repeats (9-35) has been identified in normal controls, and repeat numbers in excess of 40 have been described as pathological. The huntingtin locus is large, spanning 180 kb and consisting of 67 exons. The huntingtin gene is widely expressed and is required for normal development. It is expressed as 2 alternatively polyadenylated forms displaying different relative abundance in various fetal and adult tissues. The larger transcript is approximately 13.7 kb and is expressed predominantly in adult and fetal brain whereas the smaller transcript of approximately 10.3 kb is more widely expressed. The genetic defect leading to Huntington's disease may not necessarily eliminate transcription, but may confer a new property on the mRNA or alter the function of the protein. One candidate is the huntingtin-associated protein-1, highly expressed in brain, which has increased affinity for huntingtin protein with expanded polyglutamine repeats. This gene contains an upstream open reading frame in the 5' UTR that inhibits expression of the huntingtin gene product through translational repression. [provided by RefSeq, Jul 2016]
PHENOTYPE: Null mutants gastrulate abnormally and die in utero. Conditional mutants are small with progressive neurodegeneration. Knock-ins of 20-150 CAG repeat units variably mimic Huntington's with late-onset motor defects, reactive gliosis and neuronal inclusions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310039H08Rik T C 17: 46,772,946 V45A probably benign Het
4921509C19Rik A G 2: 151,471,871 I629T unknown Het
4933402N03Rik T C 7: 131,138,684 R268G probably damaging Het
Abca13 A T 11: 9,434,193 R3882* probably null Het
Adamts3 T G 5: 89,703,007 T558P probably damaging Het
Ano2 A G 6: 125,790,341 N214S probably benign Het
Arhgef4 A T 1: 34,811,785 probably null Het
Boc C T 16: 44,500,380 A306T probably benign Het
Capn10 T C 1: 92,943,781 F367S probably damaging Het
Ccdc6 T C 10: 70,189,256 probably benign Het
Cobll1 G T 2: 65,099,028 S688R possibly damaging Het
Cpxm2 G T 7: 132,049,038 P631Q possibly damaging Het
Cyp2c68 A G 19: 39,699,335 V406A possibly damaging Het
Cyp4a30b T A 4: 115,455,003 Y118N probably damaging Het
Dgki A T 6: 37,299,846 probably benign Het
Disp2 A G 2: 118,792,756 N1323S probably damaging Het
Dock1 T A 7: 134,724,409 Y42* probably null Het
Eps8l1 C A 7: 4,473,945 P471Q probably damaging Het
Fam20a A C 11: 109,721,687 L10R unknown Het
Fpr-rs4 T A 17: 18,022,184 I151K probably damaging Het
Gga1 C A 15: 78,885,309 P161T probably damaging Het
Gm8909 A T 17: 36,165,858 H241Q possibly damaging Het
Gm9923 T A 10: 72,309,476 Y52* probably null Het
Gucy2g A G 19: 55,206,256 F910L probably damaging Het
Helz T C 11: 107,649,145 V315A probably damaging Het
Hk2 T C 6: 82,739,648 Y301C probably damaging Het
Iah1 T C 12: 21,316,433 M1T probably null Het
Ik T C 18: 36,752,414 S287P probably damaging Het
Itga1 T A 13: 115,049,370 D32V probably damaging Het
Itpr2 A G 6: 146,373,173 F837S probably damaging Het
Klk14 A G 7: 43,691,968 I15V probably benign Het
Kng2 T C 16: 22,987,641 I603V possibly damaging Het
Lama1 T C 17: 67,773,778 I1267T possibly damaging Het
Lrp1b A C 2: 40,922,304 L2430V probably benign Het
Lrrn3 T G 12: 41,454,244 K25Q possibly damaging Het
Lta4h T A 10: 93,468,816 N233K probably benign Het
Mapk13 T C 17: 28,770,049 I53T probably damaging Het
Mdn1 T C 4: 32,666,430 F123L probably damaging Het
Mettl7b G T 10: 128,960,702 C79* probably null Het
Myh4 G C 11: 67,245,811 D472H probably damaging Het
Nipa2 A T 7: 55,935,826 N121K probably benign Het
Nostrin C T 2: 69,183,924 T408M probably benign Het
Olfr347 A G 2: 36,734,674 M118V probably damaging Het
Olfr725 T C 14: 50,034,830 D191G probably damaging Het
Oosp2 C T 19: 11,649,653 R102H probably damaging Het
Osgin2 T A 4: 16,001,946 I202L probably benign Het
Pbld2 C A 10: 63,057,697 R271S probably damaging Het
Pex6 C T 17: 46,712,101 T201I probably benign Het
Pilra T C 5: 137,835,515 I96M probably damaging Het
Pllp T A 8: 94,677,278 D47V possibly damaging Het
Plxna2 A G 1: 194,762,594 S765G probably benign Het
Prkca A T 11: 107,961,608 Y100N probably damaging Het
Prkg1 T A 19: 31,664,179 K35* probably null Het
Psmc2 A G 5: 21,803,265 D389G possibly damaging Het
Rnf213 A G 11: 119,441,125 T2387A probably damaging Het
Ros1 T C 10: 52,129,096 N914S probably damaging Het
Ruvbl1 C A 6: 88,491,599 T367K probably benign Het
Scube2 C T 7: 109,810,713 R525H probably damaging Het
Sec14l4 T C 11: 4,035,200 probably null Het
Secisbp2l T C 2: 125,745,942 D751G probably damaging Het
Setd3 T C 12: 108,108,690 D402G probably benign Het
Slc15a2 T A 16: 36,757,849 K359N probably damaging Het
Slc25a21 A G 12: 57,196,936 S2P probably benign Het
Slfn8 A T 11: 83,017,506 H70Q probably benign Het
Spef2 T C 15: 9,647,490 I944V probably benign Het
Spg11 A G 2: 122,065,076 F1887S probably damaging Het
Sptbn4 T C 7: 27,364,419 E879G probably damaging Het
Sptbn4 A T 7: 27,366,735 D649E possibly damaging Het
Stx5a C A 19: 8,743,361 R121S probably damaging Het
Tbcd T C 11: 121,493,771 L26P probably damaging Het
Tecpr1 T C 5: 144,207,437 D649G probably benign Het
Tfam A G 10: 71,237,847 S32P probably benign Het
Trmt44 C T 5: 35,558,043 R642H probably benign Het
Trpm3 G A 19: 22,987,781 A1547T probably benign Het
Ttll6 T C 11: 96,153,177 V519A probably benign Het
Umodl1 T C 17: 30,998,114 F1107L probably benign Het
Usp5 A T 6: 124,817,956 V677E probably damaging Het
Utp20 A T 10: 88,807,445 L605* probably null Het
Utrn T C 10: 12,745,240 D229G probably damaging Het
Uty A T Y: 1,176,502 L178* probably null Het
Vmn2r88 A T 14: 51,413,334 D168V possibly damaging Het
Vps13b T C 15: 35,646,178 V1476A probably damaging Het
Vps13b C T 15: 35,841,341 H2506Y probably benign Het
Vps13b C A 15: 35,879,821 T3014K probably benign Het
Vps37c T C 19: 10,712,768 V198A probably benign Het
Zfc3h1 T C 10: 115,423,385 Y1621H probably benign Het
Zfp251 T C 15: 76,854,407 D162G possibly damaging Het
Zfp292 T C 4: 34,807,078 T1994A probably benign Het
Zfp791 A G 8: 85,110,930 Y102H probably benign Het
Other mutations in Htt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Htt APN 5 34799408 missense probably benign 0.00
IGL00233:Htt APN 5 34896026 splice site probably null
IGL00559:Htt APN 5 34849104 splice site probably benign
IGL00765:Htt APN 5 34877425 splice site probably benign
IGL00950:Htt APN 5 34891441 missense probably benign
IGL00953:Htt APN 5 34818677 missense probably benign 0.04
IGL00957:Htt APN 5 34806724 missense probably benign
IGL01314:Htt APN 5 34878856 missense probably benign
IGL01412:Htt APN 5 34898572 missense probably damaging 0.98
IGL01510:Htt APN 5 34907512 missense probably damaging 1.00
IGL01617:Htt APN 5 34876755 missense possibly damaging 0.67
IGL01893:Htt APN 5 34876830 missense probably damaging 1.00
IGL01914:Htt APN 5 34829709 missense probably benign
IGL01994:Htt APN 5 34832604 missense possibly damaging 0.83
IGL02102:Htt APN 5 34891481 splice site probably benign
IGL02381:Htt APN 5 34829760 missense probably benign 0.03
IGL02529:Htt APN 5 34819043 splice site probably benign
IGL02678:Htt APN 5 34899902 missense probably damaging 1.00
IGL02707:Htt APN 5 34829881 critical splice donor site probably null
IGL02731:Htt APN 5 34803793 missense probably benign 0.41
IGL02931:Htt APN 5 34876753 missense probably damaging 1.00
IGL03167:Htt APN 5 34818986 missense probably damaging 0.98
IGL03343:Htt APN 5 34826041 missense probably benign
IGL03344:Htt APN 5 34907466 missense probably benign 0.02
IGL03344:Htt APN 5 34879828 missense probably benign 0.39
IGL03366:Htt APN 5 34907580 missense probably damaging 1.00
IGL03410:Htt APN 5 34799445 missense probably damaging 0.99
Chalk UTSW 5 34907086 missense possibly damaging 0.86
IGL02796:Htt UTSW 5 34877482 missense probably benign 0.43
PIT4377001:Htt UTSW 5 34875965 missense probably benign 0.10
R0013:Htt UTSW 5 34820104 missense probably benign 0.25
R0049:Htt UTSW 5 34908662 missense probably damaging 0.97
R0049:Htt UTSW 5 34908662 missense probably damaging 0.97
R0056:Htt UTSW 5 34826078 splice site probably benign
R0207:Htt UTSW 5 34896908 missense probably benign 0.11
R0329:Htt UTSW 5 34817134 splice site probably benign
R0494:Htt UTSW 5 34821844 missense possibly damaging 0.73
R0548:Htt UTSW 5 34870746 missense probably damaging 1.00
R0601:Htt UTSW 5 34846003 missense probably benign 0.08
R0799:Htt UTSW 5 34817753 missense probably benign 0.00
R0947:Htt UTSW 5 34898924 missense probably damaging 1.00
R1053:Htt UTSW 5 34851217 critical splice acceptor site probably null
R1147:Htt UTSW 5 34851252 missense probably damaging 0.98
R1147:Htt UTSW 5 34851252 missense probably damaging 0.98
R1478:Htt UTSW 5 34803827 missense probably damaging 0.99
R1573:Htt UTSW 5 34864374 splice site probably benign
R1677:Htt UTSW 5 34828574 missense probably damaging 1.00
R1792:Htt UTSW 5 34907199 missense probably damaging 1.00
R1816:Htt UTSW 5 34803740 missense probably benign 0.01
R1833:Htt UTSW 5 34905748 splice site probably benign
R1837:Htt UTSW 5 34819023 missense probably benign 0.00
R1846:Htt UTSW 5 34848944 missense probably damaging 0.98
R1875:Htt UTSW 5 34794112 missense probably benign 0.05
R1899:Htt UTSW 5 34907085 missense probably benign 0.01
R2013:Htt UTSW 5 34852871 missense probably damaging 0.99
R2062:Htt UTSW 5 34825982 missense probably benign 0.00
R2064:Htt UTSW 5 34825982 missense probably benign 0.00
R2067:Htt UTSW 5 34825982 missense probably benign 0.00
R2068:Htt UTSW 5 34825982 missense probably benign 0.00
R2131:Htt UTSW 5 34877109 missense possibly damaging 0.50
R2162:Htt UTSW 5 34821718 missense probably benign 0.44
R2169:Htt UTSW 5 34877475 missense probably benign 0.08
R2345:Htt UTSW 5 34826004 missense possibly damaging 0.80
R2433:Htt UTSW 5 34907541 missense possibly damaging 0.65
R3027:Htt UTSW 5 34820095 missense possibly damaging 0.85
R3123:Htt UTSW 5 34804531 missense probably benign
R3125:Htt UTSW 5 34804531 missense probably benign
R3717:Htt UTSW 5 34811522 splice site probably benign
R3758:Htt UTSW 5 34895970 missense probably damaging 0.97
R3805:Htt UTSW 5 34877204 splice site probably null
R3833:Htt UTSW 5 34821718 missense probably benign 0.44
R4066:Htt UTSW 5 34878847 missense probably benign
R4272:Htt UTSW 5 34849069 missense possibly damaging 0.96
R4625:Htt UTSW 5 34829785 missense probably damaging 0.99
R4634:Htt UTSW 5 34875948 missense probably benign 0.06
R4655:Htt UTSW 5 34906132 missense probably benign 0.06
R4679:Htt UTSW 5 34820080 missense probably benign
R4832:Htt UTSW 5 34824840 missense probably benign 0.01
R4833:Htt UTSW 5 34852225 missense probably damaging 0.98
R4973:Htt UTSW 5 34813023 missense probably damaging 0.99
R5095:Htt UTSW 5 34824395 missense possibly damaging 0.89
R5132:Htt UTSW 5 34905679 missense possibly damaging 0.89
R5351:Htt UTSW 5 34803833 missense probably damaging 0.99
R5361:Htt UTSW 5 34907584 missense possibly damaging 0.47
R5399:Htt UTSW 5 34877151 missense probably damaging 0.98
R5462:Htt UTSW 5 34885507 nonsense probably null
R5552:Htt UTSW 5 34821774 missense probably benign
R5566:Htt UTSW 5 34849075 missense probably damaging 1.00
R5595:Htt UTSW 5 34905397 missense probably damaging 0.96
R5617:Htt UTSW 5 34870806 missense possibly damaging 0.77
R5835:Htt UTSW 5 34813190 missense probably benign 0.16
R5891:Htt UTSW 5 34870823 missense possibly damaging 0.62
R6158:Htt UTSW 5 34907086 missense possibly damaging 0.86
R6159:Htt UTSW 5 34804676 missense probably benign 0.08
R6169:Htt UTSW 5 34907473 missense probably damaging 1.00
R6242:Htt UTSW 5 34846012 missense probably damaging 1.00
R6274:Htt UTSW 5 34852087 missense possibly damaging 0.81
R6280:Htt UTSW 5 34870759 missense probably benign 0.00
R6294:Htt UTSW 5 34821826 missense probably benign
R6331:Htt UTSW 5 34895887 missense possibly damaging 0.89
R6448:Htt UTSW 5 34875992 missense probably benign 0.05
R6474:Htt UTSW 5 34824895 missense probably benign 0.06
R6592:Htt UTSW 5 34877044 missense possibly damaging 0.92
R6818:Htt UTSW 5 34782767 missense probably damaging 0.99
R6830:Htt UTSW 5 34834326 missense possibly damaging 0.82
R6920:Htt UTSW 5 34877100 missense probably null 1.00
R6962:Htt UTSW 5 34899771 critical splice acceptor site probably null
R7057:Htt UTSW 5 34821723 missense probably null 0.05
R7144:Htt UTSW 5 34846006 missense probably damaging 1.00
R7166:Htt UTSW 5 34852894 missense probably benign 0.42
R7329:Htt UTSW 5 34829755 missense probably benign 0.03
R7378:Htt UTSW 5 34803799 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CACATGTGCTAAGCAGTTTACC -3'
(R):5'- CCATGCTGTGATGTGGGTATCC -3'

Sequencing Primer
(F):5'- ATGTGCTAAGCAGTTTACCTCCAATC -3'
(R):5'- ATGTGGGTATCCCTGTGCTTTCC -3'
Posted On2015-10-21