Incidental Mutation 'R4684:Itpr2'
ID353514
Institutional Source Beutler Lab
Gene Symbol Itpr2
Ensembl Gene ENSMUSG00000030287
Gene Nameinositol 1,4,5-triphosphate receptor 2
SynonymsItpr5, Ip3r2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4684 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location146108299-146502223 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 146373173 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 837 (F837S)
Ref Sequence ENSEMBL: ENSMUSP00000049584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053273] [ENSMUST00000079573] [ENSMUST00000131890] [ENSMUST00000139732]
Predicted Effect probably damaging
Transcript: ENSMUST00000053273
AA Change: F837S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000049584
Gene: ENSMUSG00000030287
AA Change: F837S

DomainStartEndE-ValueType
low complexity region 68 80 N/A INTRINSIC
MIR 112 166 1.1e-5 SMART
MIR 173 223 8.9e-6 SMART
MIR 231 287 5.11e-6 SMART
MIR 294 402 3.73e-8 SMART
Pfam:RYDR_ITPR 473 670 1.5e-62 PFAM
low complexity region 882 890 N/A INTRINSIC
Pfam:RYDR_ITPR 1183 1346 1.6e-16 PFAM
low complexity region 1773 1785 N/A INTRINSIC
low complexity region 1897 1908 N/A INTRINSIC
Pfam:RIH_assoc 1912 2022 4.6e-34 PFAM
low complexity region 2088 2098 N/A INTRINSIC
transmembrane domain 2228 2250 N/A INTRINSIC
Pfam:Ion_trans 2260 2552 5.1e-20 PFAM
coiled coil region 2631 2686 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000079573
AA Change: F804S

PolyPhen 2 Score 0.733 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000078526
Gene: ENSMUSG00000030287
AA Change: F804S

DomainStartEndE-ValueType
low complexity region 68 80 N/A INTRINSIC
MIR 112 166 1.1e-5 SMART
MIR 198 254 5.11e-6 SMART
MIR 261 369 3.73e-8 SMART
Pfam:RYDR_ITPR 438 644 5.4e-75 PFAM
low complexity region 849 857 N/A INTRINSIC
Pfam:RYDR_ITPR 1148 1322 7.2e-60 PFAM
low complexity region 1740 1752 N/A INTRINSIC
Pfam:RIH_assoc 1875 1994 5.8e-35 PFAM
low complexity region 2055 2065 N/A INTRINSIC
transmembrane domain 2195 2217 N/A INTRINSIC
transmembrane domain 2230 2249 N/A INTRINSIC
low complexity region 2268 2279 N/A INTRINSIC
Pfam:Ion_trans 2281 2507 2.4e-12 PFAM
coiled coil region 2598 2653 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000131890
AA Change: F479S

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000121773
Gene: ENSMUSG00000030287
AA Change: F479S

DomainStartEndE-ValueType
Pfam:MIR 1 74 4.8e-22 PFAM
Pfam:RYDR_ITPR 113 319 1.9e-76 PFAM
low complexity region 524 532 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139732
SMART Domains Protein: ENSMUSP00000119110
Gene: ENSMUSG00000030287

DomainStartEndE-ValueType
low complexity region 21 33 N/A INTRINSIC
MIR 65 119 1.1e-5 SMART
MIR 126 176 8.9e-6 SMART
MIR 184 240 5.11e-6 SMART
MIR 247 355 3.73e-8 SMART
Pfam:RYDR_ITPR 424 630 3e-76 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204247
Meta Mutation Damage Score 0.346 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the inositol 1,4,5-triphosphate receptor family, whose members are second messenger intracellular calcium release channels. These proteins mediate a rise in cytoplasmic calcium in response to receptor activated production of inositol triphosphate. Inositol triphosphate receptor-mediated signaling is involved in many processes including cell migration, cell division, smooth muscle contraction, and neuronal signaling. This protein is a type 2 receptor that consists of a cytoplasmic amino-terminus that binds inositol triphosphate, six membrane-spanning helices that contribute to the ion pore, and a short cytoplasmic carboxy-terminus. A mutation in this gene has been associated with anhidrosis, suggesting that intracellular calcium release mediated by this protein is required for eccrine sweat production. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygotes for a knock-out allele are viable and fertile but show decreased sweating and disturbed calcium signaling in sweat glands. Mice homozygous for a different knock-out allele have atrial myocytes that are significantly less prone to develop proarrhythmic disturbances in calcium signaling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310039H08Rik T C 17: 46,772,946 V45A probably benign Het
4921509C19Rik A G 2: 151,471,871 I629T unknown Het
4933402N03Rik T C 7: 131,138,684 R268G probably damaging Het
Abca13 A T 11: 9,434,193 R3882* probably null Het
Adamts3 T G 5: 89,703,007 T558P probably damaging Het
Ano2 A G 6: 125,790,341 N214S probably benign Het
Arhgef4 A T 1: 34,811,785 probably null Het
Boc C T 16: 44,500,380 A306T probably benign Het
Capn10 T C 1: 92,943,781 F367S probably damaging Het
Ccdc6 T C 10: 70,189,256 probably benign Het
Cobll1 G T 2: 65,099,028 S688R possibly damaging Het
Cpxm2 G T 7: 132,049,038 P631Q possibly damaging Het
Cyp2c68 A G 19: 39,699,335 V406A possibly damaging Het
Cyp4a30b T A 4: 115,455,003 Y118N probably damaging Het
Dgki A T 6: 37,299,846 probably benign Het
Disp2 A G 2: 118,792,756 N1323S probably damaging Het
Dock1 T A 7: 134,724,409 Y42* probably null Het
Eps8l1 C A 7: 4,473,945 P471Q probably damaging Het
Fam20a A C 11: 109,721,687 L10R unknown Het
Fpr-rs4 T A 17: 18,022,184 I151K probably damaging Het
Gga1 C A 15: 78,885,309 P161T probably damaging Het
Gm8909 A T 17: 36,165,858 H241Q possibly damaging Het
Gm9923 T A 10: 72,309,476 Y52* probably null Het
Gucy2g A G 19: 55,206,256 F910L probably damaging Het
Helz T C 11: 107,649,145 V315A probably damaging Het
Hk2 T C 6: 82,739,648 Y301C probably damaging Het
Htt C T 5: 34,852,765 P1521S probably damaging Het
Iah1 T C 12: 21,316,433 M1T probably null Het
Ik T C 18: 36,752,414 S287P probably damaging Het
Itga1 T A 13: 115,049,370 D32V probably damaging Het
Klk14 A G 7: 43,691,968 I15V probably benign Het
Kng2 T C 16: 22,987,641 I603V possibly damaging Het
Lama1 T C 17: 67,773,778 I1267T possibly damaging Het
Lrp1b A C 2: 40,922,304 L2430V probably benign Het
Lrrn3 T G 12: 41,454,244 K25Q possibly damaging Het
Lta4h T A 10: 93,468,816 N233K probably benign Het
Mapk13 T C 17: 28,770,049 I53T probably damaging Het
Mdn1 T C 4: 32,666,430 F123L probably damaging Het
Mettl7b G T 10: 128,960,702 C79* probably null Het
Myh4 G C 11: 67,245,811 D472H probably damaging Het
Nipa2 A T 7: 55,935,826 N121K probably benign Het
Nostrin C T 2: 69,183,924 T408M probably benign Het
Olfr347 A G 2: 36,734,674 M118V probably damaging Het
Olfr725 T C 14: 50,034,830 D191G probably damaging Het
Oosp2 C T 19: 11,649,653 R102H probably damaging Het
Osgin2 T A 4: 16,001,946 I202L probably benign Het
Pbld2 C A 10: 63,057,697 R271S probably damaging Het
Pex6 C T 17: 46,712,101 T201I probably benign Het
Pilra T C 5: 137,835,515 I96M probably damaging Het
Pllp T A 8: 94,677,278 D47V possibly damaging Het
Plxna2 A G 1: 194,762,594 S765G probably benign Het
Prkca A T 11: 107,961,608 Y100N probably damaging Het
Prkg1 T A 19: 31,664,179 K35* probably null Het
Psmc2 A G 5: 21,803,265 D389G possibly damaging Het
Rnf213 A G 11: 119,441,125 T2387A probably damaging Het
Ros1 T C 10: 52,129,096 N914S probably damaging Het
Ruvbl1 C A 6: 88,491,599 T367K probably benign Het
Scube2 C T 7: 109,810,713 R525H probably damaging Het
Sec14l4 T C 11: 4,035,200 probably null Het
Secisbp2l T C 2: 125,745,942 D751G probably damaging Het
Setd3 T C 12: 108,108,690 D402G probably benign Het
Slc15a2 T A 16: 36,757,849 K359N probably damaging Het
Slc25a21 A G 12: 57,196,936 S2P probably benign Het
Slfn8 A T 11: 83,017,506 H70Q probably benign Het
Spef2 T C 15: 9,647,490 I944V probably benign Het
Spg11 A G 2: 122,065,076 F1887S probably damaging Het
Sptbn4 T C 7: 27,364,419 E879G probably damaging Het
Sptbn4 A T 7: 27,366,735 D649E possibly damaging Het
Stx5a C A 19: 8,743,361 R121S probably damaging Het
Tbcd T C 11: 121,493,771 L26P probably damaging Het
Tecpr1 T C 5: 144,207,437 D649G probably benign Het
Tfam A G 10: 71,237,847 S32P probably benign Het
Trmt44 C T 5: 35,558,043 R642H probably benign Het
Trpm3 G A 19: 22,987,781 A1547T probably benign Het
Ttll6 T C 11: 96,153,177 V519A probably benign Het
Umodl1 T C 17: 30,998,114 F1107L probably benign Het
Usp5 A T 6: 124,817,956 V677E probably damaging Het
Utp20 A T 10: 88,807,445 L605* probably null Het
Utrn T C 10: 12,745,240 D229G probably damaging Het
Uty A T Y: 1,176,502 L178* probably null Het
Vmn2r88 A T 14: 51,413,334 D168V possibly damaging Het
Vps13b T C 15: 35,646,178 V1476A probably damaging Het
Vps13b C T 15: 35,841,341 H2506Y probably benign Het
Vps13b C A 15: 35,879,821 T3014K probably benign Het
Vps37c T C 19: 10,712,768 V198A probably benign Het
Zfc3h1 T C 10: 115,423,385 Y1621H probably benign Het
Zfp251 T C 15: 76,854,407 D162G possibly damaging Het
Zfp292 T C 4: 34,807,078 T1994A probably benign Het
Zfp791 A G 8: 85,110,930 Y102H probably benign Het
Other mutations in Itpr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Itpr2 APN 6 146397012 missense probably damaging 0.99
IGL00163:Itpr2 APN 6 146390836 missense possibly damaging 0.88
IGL00229:Itpr2 APN 6 146144185 missense probably damaging 1.00
IGL00712:Itpr2 APN 6 146232436 missense possibly damaging 0.63
IGL00952:Itpr2 APN 6 146158961 missense probably damaging 1.00
IGL00983:Itpr2 APN 6 146310981 splice site probably benign
IGL01012:Itpr2 APN 6 146345161 missense probably damaging 1.00
IGL01289:Itpr2 APN 6 146112535 nonsense probably null
IGL01411:Itpr2 APN 6 146376062 critical splice donor site probably null
IGL01557:Itpr2 APN 6 146158976 missense probably damaging 0.99
IGL01669:Itpr2 APN 6 146180229 missense probably damaging 1.00
IGL01809:Itpr2 APN 6 146227581 missense probably damaging 1.00
IGL01814:Itpr2 APN 6 146232546 missense probably benign 0.02
IGL02198:Itpr2 APN 6 146323227 missense probably damaging 1.00
IGL02218:Itpr2 APN 6 146240262 splice site probably benign
IGL02332:Itpr2 APN 6 146426542 missense probably damaging 1.00
IGL02425:Itpr2 APN 6 146391321 missense probably damaging 0.99
IGL02432:Itpr2 APN 6 146325173 missense probably benign 0.05
IGL02726:Itpr2 APN 6 146375921 missense probably benign 0.18
IGL02851:Itpr2 APN 6 146385979 missense probably damaging 0.99
IGL02933:Itpr2 APN 6 146312904 missense probably benign
IGL03015:Itpr2 APN 6 146375937 missense probably benign
IGL03067:Itpr2 APN 6 146325182 missense probably damaging 1.00
IGL03093:Itpr2 APN 6 146379510 missense probably damaging 1.00
IGL03214:Itpr2 APN 6 146180244 missense probably benign 0.02
IGL03275:Itpr2 APN 6 146158877 splice site probably benign
IGL03332:Itpr2 APN 6 146144149 missense probably damaging 0.98
IGL03352:Itpr2 APN 6 146157104 missense probably damaging 1.00
IGL03377:Itpr2 APN 6 146329715 missense probably damaging 0.96
IGL03377:Itpr2 APN 6 146329758 missense probably benign
enfermos UTSW 6 146234006 missense probably damaging 0.98
P0029:Itpr2 UTSW 6 146379489 missense probably damaging 1.00
PIT4431001:Itpr2 UTSW 6 146354720 missense probably benign
PIT4453001:Itpr2 UTSW 6 146373173 missense probably damaging 1.00
PIT4504001:Itpr2 UTSW 6 146229871 missense probably damaging 0.99
R0040:Itpr2 UTSW 6 146345140 missense probably damaging 1.00
R0040:Itpr2 UTSW 6 146345140 missense probably damaging 1.00
R0048:Itpr2 UTSW 6 146232291 splice site probably null
R0048:Itpr2 UTSW 6 146232291 splice site probably null
R0055:Itpr2 UTSW 6 146323133 missense probably benign 0.42
R0055:Itpr2 UTSW 6 146323133 missense probably benign 0.42
R0088:Itpr2 UTSW 6 146241185 missense probably benign
R0089:Itpr2 UTSW 6 146350022 critical splice donor site probably null
R0114:Itpr2 UTSW 6 146312879 missense probably damaging 1.00
R0125:Itpr2 UTSW 6 146240453 missense probably benign 0.00
R0144:Itpr2 UTSW 6 146327155 missense probably damaging 0.98
R0180:Itpr2 UTSW 6 146501909 start gained probably benign
R0211:Itpr2 UTSW 6 146194613 missense probably benign 0.17
R0305:Itpr2 UTSW 6 146311103 missense possibly damaging 0.63
R0367:Itpr2 UTSW 6 146234008 missense probably damaging 1.00
R0374:Itpr2 UTSW 6 146359392 missense probably benign 0.00
R0391:Itpr2 UTSW 6 146229773 missense probably damaging 1.00
R0450:Itpr2 UTSW 6 146417979 missense possibly damaging 0.66
R0464:Itpr2 UTSW 6 146375889 missense probably damaging 1.00
R0510:Itpr2 UTSW 6 146417979 missense possibly damaging 0.66
R0532:Itpr2 UTSW 6 146112400 missense probably damaging 1.00
R0625:Itpr2 UTSW 6 146166651 missense probably benign
R0633:Itpr2 UTSW 6 146374456 missense probably damaging 1.00
R0636:Itpr2 UTSW 6 146171412 missense probably damaging 1.00
R1086:Itpr2 UTSW 6 146350045 missense probably damaging 1.00
R1352:Itpr2 UTSW 6 146111742 missense probably damaging 1.00
R1631:Itpr2 UTSW 6 146180290 missense probably damaging 1.00
R1655:Itpr2 UTSW 6 146376148 missense probably damaging 1.00
R1767:Itpr2 UTSW 6 146350068 missense possibly damaging 0.91
R1779:Itpr2 UTSW 6 146158901 nonsense probably null
R1796:Itpr2 UTSW 6 146296673 missense probably benign
R1815:Itpr2 UTSW 6 146359416 missense probably benign 0.08
R1827:Itpr2 UTSW 6 146328332 missense probably damaging 1.00
R1828:Itpr2 UTSW 6 146328332 missense probably damaging 1.00
R1884:Itpr2 UTSW 6 146385971 missense probably benign 0.16
R1902:Itpr2 UTSW 6 146229703 missense probably damaging 1.00
R1931:Itpr2 UTSW 6 146240354 missense probably benign 0.41
R1964:Itpr2 UTSW 6 146111693 missense probably damaging 1.00
R2010:Itpr2 UTSW 6 146227524 synonymous probably null
R2168:Itpr2 UTSW 6 146111678 missense probably benign 0.05
R2179:Itpr2 UTSW 6 146375966 missense probably benign
R2290:Itpr2 UTSW 6 146422828 missense probably damaging 1.00
R2874:Itpr2 UTSW 6 146426498 missense possibly damaging 0.73
R2888:Itpr2 UTSW 6 146171293 missense probably damaging 1.00
R2897:Itpr2 UTSW 6 146173341 missense probably benign 0.03
R2897:Itpr2 UTSW 6 146323169 missense probably damaging 1.00
R2898:Itpr2 UTSW 6 146173341 missense probably benign 0.03
R2898:Itpr2 UTSW 6 146323169 missense probably damaging 1.00
R3024:Itpr2 UTSW 6 146180310 missense probably benign 0.35
R3104:Itpr2 UTSW 6 146312837 critical splice donor site probably null
R3607:Itpr2 UTSW 6 146227601 missense probably damaging 0.98
R3732:Itpr2 UTSW 6 146382700 missense probably damaging 1.00
R3732:Itpr2 UTSW 6 146382700 missense probably damaging 1.00
R3733:Itpr2 UTSW 6 146382700 missense probably damaging 1.00
R3792:Itpr2 UTSW 6 146415354 missense probably damaging 1.00
R3806:Itpr2 UTSW 6 146232291 splice site probably null
R3821:Itpr2 UTSW 6 146417726 missense probably damaging 1.00
R3929:Itpr2 UTSW 6 146374359 splice site probably null
R3958:Itpr2 UTSW 6 146425510 missense probably damaging 0.97
R3959:Itpr2 UTSW 6 146425510 missense probably damaging 0.97
R3960:Itpr2 UTSW 6 146229764 missense probably damaging 1.00
R3960:Itpr2 UTSW 6 146425510 missense probably damaging 0.97
R4074:Itpr2 UTSW 6 146373244 splice site probably null
R4085:Itpr2 UTSW 6 146144248 missense probably damaging 1.00
R4114:Itpr2 UTSW 6 146425510 missense probably damaging 0.97
R4115:Itpr2 UTSW 6 146425510 missense probably damaging 0.97
R4588:Itpr2 UTSW 6 146241196 missense probably benign 0.33
R4663:Itpr2 UTSW 6 146373173 missense probably damaging 1.00
R4673:Itpr2 UTSW 6 146373173 missense probably damaging 1.00
R4686:Itpr2 UTSW 6 146229775 missense probably damaging 1.00
R4713:Itpr2 UTSW 6 146373173 missense probably damaging 1.00
R4713:Itpr2 UTSW 6 146396958 missense probably damaging 1.00
R4729:Itpr2 UTSW 6 146373173 missense probably damaging 1.00
R4732:Itpr2 UTSW 6 146373173 missense probably damaging 1.00
R4733:Itpr2 UTSW 6 146373173 missense probably damaging 1.00
R4801:Itpr2 UTSW 6 146371331 missense probably damaging 1.00
R4802:Itpr2 UTSW 6 146371331 missense probably damaging 1.00
R4877:Itpr2 UTSW 6 146325205 missense probably damaging 1.00
R4970:Itpr2 UTSW 6 146233991 missense possibly damaging 0.95
R4986:Itpr2 UTSW 6 146240342 missense probably damaging 0.96
R5112:Itpr2 UTSW 6 146233991 missense possibly damaging 0.95
R5200:Itpr2 UTSW 6 146144107 critical splice donor site probably null
R5224:Itpr2 UTSW 6 146166651 missense probably benign
R5243:Itpr2 UTSW 6 146187546 missense probably damaging 1.00
R5348:Itpr2 UTSW 6 146476693 missense possibly damaging 0.78
R5393:Itpr2 UTSW 6 146376155 nonsense probably null
R5552:Itpr2 UTSW 6 146294080 missense probably benign
R5579:Itpr2 UTSW 6 146173366 nonsense probably null
R5744:Itpr2 UTSW 6 146376151 missense probably damaging 1.00
R5825:Itpr2 UTSW 6 146144149 missense probably damaging 0.98
R5910:Itpr2 UTSW 6 146329571 missense probably benign 0.10
R5911:Itpr2 UTSW 6 146312943 missense probably benign 0.42
R6044:Itpr2 UTSW 6 146396951 missense probably null 0.98
R6072:Itpr2 UTSW 6 146347111 missense probably damaging 0.98
R6191:Itpr2 UTSW 6 146328335 missense probably benign 0.01
R6483:Itpr2 UTSW 6 146112477 missense possibly damaging 0.52
R6511:Itpr2 UTSW 6 146329727 missense probably damaging 1.00
R6524:Itpr2 UTSW 6 146345211 missense probably benign 0.01
R6561:Itpr2 UTSW 6 146234006 missense probably damaging 0.98
R6594:Itpr2 UTSW 6 146190480 missense possibly damaging 0.71
R6603:Itpr2 UTSW 6 146347171 missense probably damaging 0.98
R6736:Itpr2 UTSW 6 146325170 missense probably damaging 1.00
R6783:Itpr2 UTSW 6 146385873 critical splice donor site probably null
R6831:Itpr2 UTSW 6 146112429 missense probably damaging 1.00
R6857:Itpr2 UTSW 6 146397019 nonsense probably null
R7103:Itpr2 UTSW 6 146325074 missense probably damaging 1.00
R7111:Itpr2 UTSW 6 146325056 missense probably damaging 1.00
R7126:Itpr2 UTSW 6 146357796 nonsense probably null
R7165:Itpr2 UTSW 6 146294091 missense probably damaging 1.00
R7184:Itpr2 UTSW 6 146311087 missense possibly damaging 0.79
R7249:Itpr2 UTSW 6 146311052 missense probably damaging 1.00
R7292:Itpr2 UTSW 6 146158949 missense possibly damaging 0.95
R7342:Itpr2 UTSW 6 146327187 missense probably damaging 0.98
R7392:Itpr2 UTSW 6 146359340 missense possibly damaging 0.95
R7414:Itpr2 UTSW 6 146373208 missense probably benign 0.06
R7448:Itpr2 UTSW 6 146329508 missense probably damaging 1.00
V8831:Itpr2 UTSW 6 146385882 missense probably damaging 1.00
X0054:Itpr2 UTSW 6 146323236 missense probably damaging 1.00
X0063:Itpr2 UTSW 6 146180353 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCACCTGGTTTCTAGCAAG -3'
(R):5'- ATTGACGTGTCCAAGGCAGTG -3'

Sequencing Primer
(F):5'- GCACCTGGTTTCTAGCAAGAATAC -3'
(R):5'- TGCACTCTAGGAGTCAGACTG -3'
Posted On2015-10-21