Incidental Mutation 'R4684:Prkca'
ID353542
Institutional Source Beutler Lab
Gene Symbol Prkca
Ensembl Gene ENSMUSG00000050965
Gene Nameprotein kinase C, alpha
SynonymsPkca
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.337) question?
Stock #R4684 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location107933387-108343928 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 107961608 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 100 (Y100N)
Ref Sequence ENSEMBL: ENSMUSP00000097875 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059595] [ENSMUST00000100302]
Predicted Effect probably damaging
Transcript: ENSMUST00000059595
AA Change: Y524N

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000062392
Gene: ENSMUSG00000050965
AA Change: Y524N

DomainStartEndE-ValueType
C1 37 86 3.09e-16 SMART
C1 102 151 1.33e-15 SMART
C2 172 275 7.66e-26 SMART
S_TKc 339 597 8.85e-98 SMART
S_TK_X 598 660 1.58e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000100302
AA Change: Y100N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000097875
Gene: ENSMUSG00000050965
AA Change: Y100N

DomainStartEndE-ValueType
Pfam:Pkinase 2 173 9.3e-44 PFAM
Pfam:Pkinase_Tyr 3 159 3.7e-25 PFAM
S_TK_X 174 236 1.58e-25 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role in cells. The protein encoded by this gene is one of the PKC family members. This kinase has been reported to play roles in many different cellular processes, such as cell adhesion, cell transformation, cell cycle checkpoint, and cell volume control. Knockout studies in mice suggest that this kinase may be a fundamental regulator of cardiac contractility and Ca(2+) handling in myocytes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice show no overt macroscopic abnormalities, however examination of one line revealed increased cardiac muscle contractility and protection against heart failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310039H08Rik T C 17: 46,772,946 V45A probably benign Het
4921509C19Rik A G 2: 151,471,871 I629T unknown Het
4933402N03Rik T C 7: 131,138,684 R268G probably damaging Het
Abca13 A T 11: 9,434,193 R3882* probably null Het
Adamts3 T G 5: 89,703,007 T558P probably damaging Het
Ano2 A G 6: 125,790,341 N214S probably benign Het
Arhgef4 A T 1: 34,811,785 probably null Het
Boc C T 16: 44,500,380 A306T probably benign Het
Capn10 T C 1: 92,943,781 F367S probably damaging Het
Ccdc6 T C 10: 70,189,256 probably benign Het
Cobll1 G T 2: 65,099,028 S688R possibly damaging Het
Cpxm2 G T 7: 132,049,038 P631Q possibly damaging Het
Cyp2c68 A G 19: 39,699,335 V406A possibly damaging Het
Cyp4a30b T A 4: 115,455,003 Y118N probably damaging Het
Dgki A T 6: 37,299,846 probably benign Het
Disp2 A G 2: 118,792,756 N1323S probably damaging Het
Dock1 T A 7: 134,724,409 Y42* probably null Het
Eps8l1 C A 7: 4,473,945 P471Q probably damaging Het
Fam20a A C 11: 109,721,687 L10R unknown Het
Fpr-rs4 T A 17: 18,022,184 I151K probably damaging Het
Gga1 C A 15: 78,885,309 P161T probably damaging Het
Gm8909 A T 17: 36,165,858 H241Q possibly damaging Het
Gm9923 T A 10: 72,309,476 Y52* probably null Het
Gucy2g A G 19: 55,206,256 F910L probably damaging Het
Helz T C 11: 107,649,145 V315A probably damaging Het
Hk2 T C 6: 82,739,648 Y301C probably damaging Het
Htt C T 5: 34,852,765 P1521S probably damaging Het
Iah1 T C 12: 21,316,433 M1T probably null Het
Ik T C 18: 36,752,414 S287P probably damaging Het
Itga1 T A 13: 115,049,370 D32V probably damaging Het
Itpr2 A G 6: 146,373,173 F837S probably damaging Het
Klk14 A G 7: 43,691,968 I15V probably benign Het
Kng2 T C 16: 22,987,641 I603V possibly damaging Het
Lama1 T C 17: 67,773,778 I1267T possibly damaging Het
Lrp1b A C 2: 40,922,304 L2430V probably benign Het
Lrrn3 T G 12: 41,454,244 K25Q possibly damaging Het
Lta4h T A 10: 93,468,816 N233K probably benign Het
Mapk13 T C 17: 28,770,049 I53T probably damaging Het
Mdn1 T C 4: 32,666,430 F123L probably damaging Het
Mettl7b G T 10: 128,960,702 C79* probably null Het
Myh4 G C 11: 67,245,811 D472H probably damaging Het
Nipa2 A T 7: 55,935,826 N121K probably benign Het
Nostrin C T 2: 69,183,924 T408M probably benign Het
Olfr347 A G 2: 36,734,674 M118V probably damaging Het
Olfr725 T C 14: 50,034,830 D191G probably damaging Het
Oosp2 C T 19: 11,649,653 R102H probably damaging Het
Osgin2 T A 4: 16,001,946 I202L probably benign Het
Pbld2 C A 10: 63,057,697 R271S probably damaging Het
Pex6 C T 17: 46,712,101 T201I probably benign Het
Pilra T C 5: 137,835,515 I96M probably damaging Het
Pllp T A 8: 94,677,278 D47V possibly damaging Het
Plxna2 A G 1: 194,762,594 S765G probably benign Het
Prkg1 T A 19: 31,664,179 K35* probably null Het
Psmc2 A G 5: 21,803,265 D389G possibly damaging Het
Rnf213 A G 11: 119,441,125 T2387A probably damaging Het
Ros1 T C 10: 52,129,096 N914S probably damaging Het
Ruvbl1 C A 6: 88,491,599 T367K probably benign Het
Scube2 C T 7: 109,810,713 R525H probably damaging Het
Sec14l4 T C 11: 4,035,200 probably null Het
Secisbp2l T C 2: 125,745,942 D751G probably damaging Het
Setd3 T C 12: 108,108,690 D402G probably benign Het
Slc15a2 T A 16: 36,757,849 K359N probably damaging Het
Slc25a21 A G 12: 57,196,936 S2P probably benign Het
Slfn8 A T 11: 83,017,506 H70Q probably benign Het
Spef2 T C 15: 9,647,490 I944V probably benign Het
Spg11 A G 2: 122,065,076 F1887S probably damaging Het
Sptbn4 T C 7: 27,364,419 E879G probably damaging Het
Sptbn4 A T 7: 27,366,735 D649E possibly damaging Het
Stx5a C A 19: 8,743,361 R121S probably damaging Het
Tbcd T C 11: 121,493,771 L26P probably damaging Het
Tecpr1 T C 5: 144,207,437 D649G probably benign Het
Tfam A G 10: 71,237,847 S32P probably benign Het
Trmt44 C T 5: 35,558,043 R642H probably benign Het
Trpm3 G A 19: 22,987,781 A1547T probably benign Het
Ttll6 T C 11: 96,153,177 V519A probably benign Het
Umodl1 T C 17: 30,998,114 F1107L probably benign Het
Usp5 A T 6: 124,817,956 V677E probably damaging Het
Utp20 A T 10: 88,807,445 L605* probably null Het
Utrn T C 10: 12,745,240 D229G probably damaging Het
Uty A T Y: 1,176,502 L178* probably null Het
Vmn2r88 A T 14: 51,413,334 D168V possibly damaging Het
Vps13b T C 15: 35,646,178 V1476A probably damaging Het
Vps13b C T 15: 35,841,341 H2506Y probably benign Het
Vps13b C A 15: 35,879,821 T3014K probably benign Het
Vps37c T C 19: 10,712,768 V198A probably benign Het
Zfc3h1 T C 10: 115,423,385 Y1621H probably benign Het
Zfp251 T C 15: 76,854,407 D162G possibly damaging Het
Zfp292 T C 4: 34,807,078 T1994A probably benign Het
Zfp791 A G 8: 85,110,930 Y102H probably benign Het
Other mutations in Prkca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Prkca APN 11 108343508 missense probably benign 0.10
IGL00903:Prkca APN 11 107983974 missense probably damaging 1.00
IGL01385:Prkca APN 11 107978352 missense probably damaging 1.00
IGL01396:Prkca APN 11 108014322 missense possibly damaging 0.59
IGL01480:Prkca APN 11 108192201 missense probably damaging 1.00
IGL01480:Prkca APN 11 107986289 missense possibly damaging 0.93
IGL01516:Prkca APN 11 107961602 missense probably null 1.00
IGL01553:Prkca APN 11 108057834 missense probably benign 0.15
IGL02975:Prkca APN 11 108340677 nonsense probably null
IGL03402:Prkca APN 11 108340663 missense probably benign 0.20
R0101:Prkca UTSW 11 108057800 missense probably damaging 1.00
R0279:Prkca UTSW 11 108054111 splice site probably benign
R0454:Prkca UTSW 11 107978280 missense probably benign
R0513:Prkca UTSW 11 108014376 missense possibly damaging 0.82
R0711:Prkca UTSW 11 107981654 missense probably benign 0.16
R0894:Prkca UTSW 11 108012692 missense possibly damaging 0.66
R0966:Prkca UTSW 11 108014284 missense possibly damaging 0.56
R1432:Prkca UTSW 11 107939520 missense probably benign 0.27
R1518:Prkca UTSW 11 107978316 missense probably damaging 1.00
R1667:Prkca UTSW 11 107983946 missense probably damaging 1.00
R1795:Prkca UTSW 11 108012692 missense possibly damaging 0.66
R1909:Prkca UTSW 11 107939612 missense possibly damaging 0.68
R1932:Prkca UTSW 11 108192149 missense probably benign 0.13
R2509:Prkca UTSW 11 107979206 missense probably damaging 1.00
R3889:Prkca UTSW 11 107979240 missense probably damaging 1.00
R4018:Prkca UTSW 11 107939602 missense probably damaging 1.00
R5132:Prkca UTSW 11 108192117 splice site probably benign
R5298:Prkca UTSW 11 108012684 missense probably damaging 0.98
R5546:Prkca UTSW 11 108053980 missense probably benign 0.14
R5558:Prkca UTSW 11 107981647 missense probably damaging 1.00
R5616:Prkca UTSW 11 107978343 missense possibly damaging 0.85
R5626:Prkca UTSW 11 108057815 missense possibly damaging 0.94
R5931:Prkca UTSW 11 108014310 missense probably benign 0.01
R6061:Prkca UTSW 11 108057845 missense probably benign 0.03
R7125:Prkca UTSW 11 107984022 missense probably damaging 1.00
R7283:Prkca UTSW 11 108340645 critical splice donor site probably null
R7329:Prkca UTSW 11 108014277 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- TGCAGTCATCAATTTGCACCC -3'
(R):5'- GGCAGAATTTACCACCACCTTG -3'

Sequencing Primer
(F):5'- CCCGCTTGAAGTTTTTATGATCAG -3'
(R):5'- ACCACCTTGTTAGTGAGAGC -3'
Posted On2015-10-21