Incidental Mutation 'R4685:Ecel1'
ID353580
Institutional Source Beutler Lab
Gene Symbol Ecel1
Ensembl Gene ENSMUSG00000026247
Gene Nameendothelin converting enzyme-like 1
SynonymsXCE, DINE
MMRRC Submission 041936-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4685 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location87147655-87156521 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to T at 87152946 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125096 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027463] [ENSMUST00000160810] [ENSMUST00000161002]
Predicted Effect probably null
Transcript: ENSMUST00000027463
SMART Domains Protein: ENSMUSP00000027463
Gene: ENSMUSG00000026247

DomainStartEndE-ValueType
low complexity region 32 54 N/A INTRINSIC
transmembrane domain 60 82 N/A INTRINSIC
low complexity region 86 102 N/A INTRINSIC
Pfam:Peptidase_M13_N 124 513 6.4e-112 PFAM
Pfam:Peptidase_M13 571 774 5.2e-66 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159662
Predicted Effect probably null
Transcript: ENSMUST00000160810
SMART Domains Protein: ENSMUSP00000125557
Gene: ENSMUSG00000026247

DomainStartEndE-ValueType
low complexity region 32 54 N/A INTRINSIC
transmembrane domain 60 82 N/A INTRINSIC
low complexity region 86 102 N/A INTRINSIC
Pfam:Peptidase_M13_N 124 513 1.2e-98 PFAM
Pfam:Peptidase_M13 571 774 2.3e-72 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000161002
SMART Domains Protein: ENSMUSP00000125096
Gene: ENSMUSG00000026247

DomainStartEndE-ValueType
low complexity region 32 54 N/A INTRINSIC
transmembrane domain 60 82 N/A INTRINSIC
low complexity region 86 102 N/A INTRINSIC
Pfam:Peptidase_M13_N 124 513 6.4e-112 PFAM
Pfam:Peptidase_M13 571 774 5.2e-66 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162015
Meta Mutation Damage Score 0.632 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the M13 family of endopeptidases. Members of this family are zinc-containing type II integral-membrane proteins that are important regulators of neuropeptide and peptide hormone activity. Mutations in this gene are associated with autosomal recessive distal arthrogryposis, type 5D. This gene has multiple pseudogenes on chromosome 2. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
PHENOTYPE: Targeted mutations of this gene result in respiratory distress causing neonatal lethality due to reduced diaphram innervation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004P03Rik T C 12: 17,007,184 D104G probably damaging Het
2810021J22Rik T C 11: 58,880,924 S411P probably damaging Het
Adcy2 T C 13: 68,727,905 R493G probably benign Het
Adcy8 A G 15: 64,737,438 I874T probably benign Het
Ano2 G T 6: 125,980,124 E619* probably null Het
Apob A G 12: 8,006,456 K1613R probably benign Het
Arhgef10 T A 8: 14,956,963 F476Y probably damaging Het
Bmf G A 2: 118,546,802 A74V probably damaging Het
Cadps T C 14: 12,467,139 E925G possibly damaging Het
Ccdc162 T C 10: 41,681,686 D181G possibly damaging Het
Ccdc85c A T 12: 108,207,175 C387S probably benign Het
Cntnap5a T C 1: 116,446,680 V974A possibly damaging Het
Dnah7b T C 1: 46,211,328 F1703S probably damaging Het
Dsg3 C A 18: 20,539,736 D821E probably benign Het
Edn1 A T 13: 42,305,253 probably null Het
Egfr G A 11: 16,858,980 C58Y probably damaging Het
Fam184a T C 10: 53,698,500 N282D probably benign Het
Fhit T A 14: 9,870,091 Q63L probably damaging Het
Gabarapl2 T C 8: 111,942,518 V36A probably benign Het
Glis1 T C 4: 107,567,645 V151A probably benign Het
Gm12695 A G 4: 96,761,980 S210P probably damaging Het
Gpat4 TAGAAGA TAGA 8: 23,182,849 probably benign Het
H2-M10.4 G A 17: 36,461,796 A98V probably benign Het
Hhat C A 1: 192,595,054 G366C probably damaging Het
Hydin C A 8: 110,462,522 A1186E probably damaging Het
Itgb2 T A 10: 77,550,103 probably null Het
Kank1 C T 19: 25,410,034 A329V possibly damaging Het
Kdm4b T A 17: 56,401,675 S1070T probably benign Het
Kyat1 A G 2: 30,188,265 Y101H probably damaging Het
Lman1l T A 9: 57,609,200 I407F probably damaging Het
Map4k5 T C 12: 69,811,366 K679R probably benign Het
Mill1 A T 7: 18,255,928 D45V probably damaging Het
Myo3a T A 2: 22,407,422 Y743N probably damaging Het
Nox4 C G 7: 87,297,508 I137M probably benign Het
Odf4 A G 11: 68,922,839 probably null Het
Ostf1 A T 19: 18,581,288 D210E probably damaging Het
Paxip1 A T 5: 27,761,677 probably null Het
Pitrm1 A G 13: 6,556,542 T211A probably benign Het
Pla2g4f A G 2: 120,305,015 S393P probably damaging Het
Plppr3 T C 10: 79,867,525 T42A probably damaging Het
Plxna4 C A 6: 32,165,844 G1559W probably damaging Het
Ppp1r13l T C 7: 19,375,383 probably null Het
Prex1 C T 2: 166,638,332 V163M probably damaging Het
Prl6a1 A G 13: 27,316,324 T93A probably benign Het
Psg16 T C 7: 17,090,534 V81A probably benign Het
Rbm33 A T 5: 28,408,282 probably benign Het
Rest C T 5: 77,275,243 P298L possibly damaging Het
Rhobtb3 G A 13: 75,878,932 R441* probably null Het
Rims4 T A 2: 163,864,994 K155* probably null Het
Rps6kb1 C T 11: 86,519,887 probably null Het
Ryr2 T C 13: 11,692,646 D2835G probably damaging Het
Sc5d C T 9: 42,258,650 V92I probably benign Het
Sell A T 1: 164,066,260 I175F probably damaging Het
Serpinb6d A G 13: 33,671,228 D295G probably damaging Het
Sphk1 A G 11: 116,535,280 D96G probably damaging Het
Spns3 A T 11: 72,537,270 V228D probably damaging Het
Sspo A G 6: 48,492,894 S4500G probably damaging Het
Syt9 T A 7: 107,436,471 C232S possibly damaging Het
Terf1 A G 1: 15,818,961 I176V possibly damaging Het
Tln2 C T 9: 67,302,572 A428T probably damaging Het
Tmprss7 T C 16: 45,679,348 N321S probably benign Het
Tomm40 A G 7: 19,701,836 I323T probably benign Het
Try5 T A 6: 41,311,299 Q240L possibly damaging Het
Vmn1r213 A T 13: 23,011,630 I128L probably benign Het
Vmn2r80 T C 10: 79,194,328 F663L possibly damaging Het
Znfx1 T A 2: 167,039,030 Y278F probably damaging Het
Zpbp2 A G 11: 98,551,291 probably benign Het
Other mutations in Ecel1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01161:Ecel1 APN 1 87153193 missense possibly damaging 0.84
IGL01431:Ecel1 APN 1 87151504 missense probably damaging 0.99
IGL01992:Ecel1 APN 1 87149855 splice site probably benign
IGL02040:Ecel1 APN 1 87154923 missense probably benign 0.32
IGL02230:Ecel1 APN 1 87152194 missense probably damaging 1.00
IGL02801:Ecel1 APN 1 87152003 missense probably damaging 1.00
Capulin UTSW 1 87153301 missense probably damaging 0.99
R0139:Ecel1 UTSW 1 87154526 missense possibly damaging 0.95
R1723:Ecel1 UTSW 1 87154421 missense probably benign 0.37
R2118:Ecel1 UTSW 1 87148275 missense probably damaging 1.00
R2119:Ecel1 UTSW 1 87148275 missense probably damaging 1.00
R2120:Ecel1 UTSW 1 87148275 missense probably damaging 1.00
R2122:Ecel1 UTSW 1 87148275 missense probably damaging 1.00
R3815:Ecel1 UTSW 1 87152900 missense probably damaging 0.97
R3836:Ecel1 UTSW 1 87150656 missense probably damaging 1.00
R4211:Ecel1 UTSW 1 87152150 missense probably damaging 1.00
R4841:Ecel1 UTSW 1 87153301 missense probably damaging 0.99
R4842:Ecel1 UTSW 1 87153301 missense probably damaging 0.99
R4888:Ecel1 UTSW 1 87148727 splice site probably benign
R4976:Ecel1 UTSW 1 87151139 missense probably benign 0.17
R5032:Ecel1 UTSW 1 87154253 missense probably damaging 0.97
R5119:Ecel1 UTSW 1 87151139 missense probably benign 0.17
R5393:Ecel1 UTSW 1 87152876 missense possibly damaging 0.95
R5798:Ecel1 UTSW 1 87151483 missense probably damaging 1.00
R5862:Ecel1 UTSW 1 87149596 missense probably benign 0.19
R5874:Ecel1 UTSW 1 87148009 missense probably benign 0.24
R6341:Ecel1 UTSW 1 87150471 splice site probably null
R6351:Ecel1 UTSW 1 87149509 missense possibly damaging 0.56
R6534:Ecel1 UTSW 1 87154842 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- CAACAAGTGGACAGCTCTAGG -3'
(R):5'- GCAGCTGCAGAAGATCATCC -3'

Sequencing Primer
(F):5'- AGCTCTAGGGTGCTGATGGAG -3'
(R):5'- GAAGATCATCCCCCATGTGAGTG -3'
Posted On2015-10-21