Incidental Mutation 'R4685:Prex1'
ID353590
Institutional Source Beutler Lab
Gene Symbol Prex1
Ensembl Gene ENSMUSG00000039621
Gene Namephosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1
SynonymsP-REX1
MMRRC Submission 041936-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.294) question?
Stock #R4685 (G1)
Quality Score218
Status Validated
Chromosome2
Chromosomal Location166566342-166713832 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 166638332 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 163 (V163M)
Ref Sequence ENSEMBL: ENSMUSP00000037180 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036719] [ENSMUST00000099080]
Predicted Effect probably damaging
Transcript: ENSMUST00000036719
AA Change: V163M

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000037180
Gene: ENSMUSG00000039621
AA Change: V163M

DomainStartEndE-ValueType
low complexity region 3 27 N/A INTRINSIC
RhoGEF 48 234 3.16e-52 SMART
PH 267 389 1.02e-10 SMART
DEP 418 491 6.86e-27 SMART
DEP 519 592 3.06e-24 SMART
PDZ 628 701 4.55e-1 SMART
PDZ 712 783 5.66e-1 SMART
low complexity region 800 811 N/A INTRINSIC
low complexity region 814 825 N/A INTRINSIC
low complexity region 1109 1127 N/A INTRINSIC
low complexity region 1545 1555 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099080
SMART Domains Protein: ENSMUSP00000096679
Gene: ENSMUSG00000039621

DomainStartEndE-ValueType
Pfam:RhoGEF 5 64 3.8e-18 PFAM
PH 97 219 1.02e-10 SMART
DEP 248 321 6.86e-27 SMART
DEP 349 422 3.06e-24 SMART
PDZ 458 531 4.55e-1 SMART
PDZ 542 613 5.66e-1 SMART
low complexity region 630 641 N/A INTRINSIC
low complexity region 644 655 N/A INTRINSIC
low complexity region 939 957 N/A INTRINSIC
low complexity region 1375 1385 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152238
Meta Mutation Damage Score 0.296 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene acts as a guanine nucleotide exchange factor for the RHO family of small GTP-binding proteins (RACs). It has been shown to bind to and activate RAC1 by exchanging bound GDP for free GTP. The encoded protein, which is found mainly in the cytoplasm, is activated by phosphatidylinositol-3,4,5-trisphosphate and the beta-gamma subunits of heterotrimeric G proteins. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele have impaired neutrophil migration and autism-like social behavior with defective AMPA-mediated LTD. Mice with other alleles exhibit reduced weight, smaller livers and increased peripheral neutrophil numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004P03Rik T C 12: 17,007,184 D104G probably damaging Het
2810021J22Rik T C 11: 58,880,924 S411P probably damaging Het
Adcy2 T C 13: 68,727,905 R493G probably benign Het
Adcy8 A G 15: 64,737,438 I874T probably benign Het
Ano2 G T 6: 125,980,124 E619* probably null Het
Apob A G 12: 8,006,456 K1613R probably benign Het
Arhgef10 T A 8: 14,956,963 F476Y probably damaging Het
Bmf G A 2: 118,546,802 A74V probably damaging Het
Cadps T C 14: 12,467,139 E925G possibly damaging Het
Ccdc162 T C 10: 41,681,686 D181G possibly damaging Het
Ccdc85c A T 12: 108,207,175 C387S probably benign Het
Cntnap5a T C 1: 116,446,680 V974A possibly damaging Het
Dnah7b T C 1: 46,211,328 F1703S probably damaging Het
Dsg3 C A 18: 20,539,736 D821E probably benign Het
Ecel1 G T 1: 87,152,946 probably null Het
Edn1 A T 13: 42,305,253 probably null Het
Egfr G A 11: 16,858,980 C58Y probably damaging Het
Fam184a T C 10: 53,698,500 N282D probably benign Het
Fhit T A 14: 9,870,091 Q63L probably damaging Het
Gabarapl2 T C 8: 111,942,518 V36A probably benign Het
Glis1 T C 4: 107,567,645 V151A probably benign Het
Gm12695 A G 4: 96,761,980 S210P probably damaging Het
Gpat4 TAGAAGA TAGA 8: 23,182,849 probably benign Het
H2-M10.4 G A 17: 36,461,796 A98V probably benign Het
Hhat C A 1: 192,595,054 G366C probably damaging Het
Hydin C A 8: 110,462,522 A1186E probably damaging Het
Itgb2 T A 10: 77,550,103 probably null Het
Kank1 C T 19: 25,410,034 A329V possibly damaging Het
Kdm4b T A 17: 56,401,675 S1070T probably benign Het
Kyat1 A G 2: 30,188,265 Y101H probably damaging Het
Lman1l T A 9: 57,609,200 I407F probably damaging Het
Map4k5 T C 12: 69,811,366 K679R probably benign Het
Mill1 A T 7: 18,255,928 D45V probably damaging Het
Myo3a T A 2: 22,407,422 Y743N probably damaging Het
Nox4 C G 7: 87,297,508 I137M probably benign Het
Odf4 A G 11: 68,922,839 probably null Het
Ostf1 A T 19: 18,581,288 D210E probably damaging Het
Paxip1 A T 5: 27,761,677 probably null Het
Pitrm1 A G 13: 6,556,542 T211A probably benign Het
Pla2g4f A G 2: 120,305,015 S393P probably damaging Het
Plppr3 T C 10: 79,867,525 T42A probably damaging Het
Plxna4 C A 6: 32,165,844 G1559W probably damaging Het
Ppp1r13l T C 7: 19,375,383 probably null Het
Prl6a1 A G 13: 27,316,324 T93A probably benign Het
Psg16 T C 7: 17,090,534 V81A probably benign Het
Rbm33 A T 5: 28,408,282 probably benign Het
Rest C T 5: 77,275,243 P298L possibly damaging Het
Rhobtb3 G A 13: 75,878,932 R441* probably null Het
Rims4 T A 2: 163,864,994 K155* probably null Het
Rps6kb1 C T 11: 86,519,887 probably null Het
Ryr2 T C 13: 11,692,646 D2835G probably damaging Het
Sc5d C T 9: 42,258,650 V92I probably benign Het
Sell A T 1: 164,066,260 I175F probably damaging Het
Serpinb6d A G 13: 33,671,228 D295G probably damaging Het
Sphk1 A G 11: 116,535,280 D96G probably damaging Het
Spns3 A T 11: 72,537,270 V228D probably damaging Het
Sspo A G 6: 48,492,894 S4500G probably damaging Het
Syt9 T A 7: 107,436,471 C232S possibly damaging Het
Terf1 A G 1: 15,818,961 I176V possibly damaging Het
Tln2 C T 9: 67,302,572 A428T probably damaging Het
Tmprss7 T C 16: 45,679,348 N321S probably benign Het
Tomm40 A G 7: 19,701,836 I323T probably benign Het
Try5 T A 6: 41,311,299 Q240L possibly damaging Het
Vmn1r213 A T 13: 23,011,630 I128L probably benign Het
Vmn2r80 T C 10: 79,194,328 F663L possibly damaging Het
Znfx1 T A 2: 167,039,030 Y278F probably damaging Het
Zpbp2 A G 11: 98,551,291 probably benign Het
Other mutations in Prex1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Prex1 APN 2 166638401 missense probably damaging 1.00
IGL00309:Prex1 APN 2 166609823 missense probably damaging 0.99
IGL00953:Prex1 APN 2 166638409 missense probably damaging 1.00
IGL00961:Prex1 APN 2 166585736 missense probably damaging 0.98
IGL01300:Prex1 APN 2 166638407 missense possibly damaging 0.46
IGL01318:Prex1 APN 2 166569340 splice site probably benign
IGL01753:Prex1 APN 2 166602882 missense probably benign 0.11
IGL01819:Prex1 APN 2 166621245 missense probably damaging 1.00
IGL02058:Prex1 APN 2 166585183 missense probably benign 0.00
IGL02251:Prex1 APN 2 166577886 missense probably damaging 0.99
IGL02326:Prex1 APN 2 166621185 missense probably benign 0.35
IGL02366:Prex1 APN 2 166580427 missense probably damaging 1.00
IGL02414:Prex1 APN 2 166609828 missense probably damaging 1.00
IGL02660:Prex1 APN 2 166593867 missense probably damaging 0.97
IGL02666:Prex1 APN 2 166572989 missense probably benign 0.00
IGL02874:Prex1 APN 2 166585047 missense probably damaging 1.00
IGL02935:Prex1 APN 2 166570345 missense probably damaging 1.00
IGL03179:Prex1 APN 2 166585194 missense probably benign 0.31
R0207:Prex1 UTSW 2 166585898 missense possibly damaging 0.92
R0415:Prex1 UTSW 2 166586699 unclassified probably benign
R0420:Prex1 UTSW 2 166589571 missense probably benign 0.13
R0449:Prex1 UTSW 2 166569377 missense probably benign 0.16
R0458:Prex1 UTSW 2 166585823 missense probably damaging 0.99
R0927:Prex1 UTSW 2 166586537 missense probably benign 0.01
R1299:Prex1 UTSW 2 166585907 missense possibly damaging 0.62
R1414:Prex1 UTSW 2 166593861 missense probably damaging 1.00
R1440:Prex1 UTSW 2 166580463 missense probably damaging 0.98
R1506:Prex1 UTSW 2 166587081 missense probably damaging 1.00
R1725:Prex1 UTSW 2 166601736 missense probably damaging 1.00
R1831:Prex1 UTSW 2 166585101 missense probably damaging 1.00
R1883:Prex1 UTSW 2 166583272 missense probably benign 0.20
R1896:Prex1 UTSW 2 166586654 missense probably benign 0.01
R2022:Prex1 UTSW 2 166575614 missense possibly damaging 0.80
R2091:Prex1 UTSW 2 166569365 missense possibly damaging 0.95
R2258:Prex1 UTSW 2 166587157 missense probably benign 0.00
R2263:Prex1 UTSW 2 166589068 splice site probably benign
R2276:Prex1 UTSW 2 166577955 missense probably benign 0.34
R2279:Prex1 UTSW 2 166577955 missense probably benign 0.34
R2680:Prex1 UTSW 2 166601772 missense possibly damaging 0.92
R3024:Prex1 UTSW 2 166589036 missense probably benign 0.04
R3421:Prex1 UTSW 2 166617854 missense probably damaging 1.00
R3614:Prex1 UTSW 2 166609781 missense probably damaging 1.00
R4244:Prex1 UTSW 2 166570336 missense probably damaging 1.00
R4605:Prex1 UTSW 2 166713544 missense probably benign 0.45
R4787:Prex1 UTSW 2 166638340 missense probably benign 0.01
R4796:Prex1 UTSW 2 166592291 missense probably damaging 1.00
R4825:Prex1 UTSW 2 166585857 nonsense probably null
R4955:Prex1 UTSW 2 166573223 missense probably damaging 0.99
R5046:Prex1 UTSW 2 166572963 missense probably benign 0.00
R5095:Prex1 UTSW 2 166581921 missense probably damaging 1.00
R5408:Prex1 UTSW 2 166575653 small insertion probably benign
R5462:Prex1 UTSW 2 166644808 missense probably benign 0.02
R5535:Prex1 UTSW 2 166580273 missense possibly damaging 0.80
R5777:Prex1 UTSW 2 166586659 missense probably damaging 1.00
R5813:Prex1 UTSW 2 166583207 missense probably benign
R5860:Prex1 UTSW 2 166644684 intron probably benign
R5984:Prex1 UTSW 2 166585744 missense probably damaging 1.00
R6009:Prex1 UTSW 2 166581984 missense probably damaging 1.00
R6174:Prex1 UTSW 2 166572963 missense probably benign 0.00
R6345:Prex1 UTSW 2 166572960 missense probably null 0.81
R6897:Prex1 UTSW 2 166581993 missense probably damaging 0.99
R6935:Prex1 UTSW 2 166599655 missense probably damaging 1.00
R7025:Prex1 UTSW 2 166613187 small insertion probably benign
R7037:Prex1 UTSW 2 166587180 missense probably benign 0.05
R7076:Prex1 UTSW 2 166633382 missense probably damaging 0.99
R7181:Prex1 UTSW 2 166570371 missense probably damaging 1.00
R7361:Prex1 UTSW 2 166713570 missense probably benign 0.04
R7381:Prex1 UTSW 2 166587127 missense probably damaging 1.00
X0065:Prex1 UTSW 2 166586625 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGGAATTATCACAGTGTGGGC -3'
(R):5'- CTGGATCTCTTCATCGCGAG -3'

Sequencing Primer
(F):5'- ATTATCACAGTGTGGGCTACAG -3'
(R):5'- AGCCTGGATCCTCTGCAAGAC -3'
Posted On2015-10-21