Incidental Mutation 'R4685:Ppp1r13l'
ID353603
Institutional Source Beutler Lab
Gene Symbol Ppp1r13l
Ensembl Gene ENSMUSG00000040734
Gene Nameprotein phosphatase 1, regulatory (inhibitor) subunit 13 like
SynonymsNFkB interacting protein 1, wa3, IASPP
MMRRC Submission 041936-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.688) question?
Stock #R4685 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location19359749-19378533 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 19375383 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000047839 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047621]
Predicted Effect probably null
Transcript: ENSMUST00000047621
SMART Domains Protein: ENSMUSP00000047839
Gene: ENSMUSG00000040734

DomainStartEndE-ValueType
coiled coil region 25 49 N/A INTRINSIC
low complexity region 349 370 N/A INTRINSIC
low complexity region 401 440 N/A INTRINSIC
low complexity region 453 472 N/A INTRINSIC
low complexity region 551 561 N/A INTRINSIC
low complexity region 575 600 N/A INTRINSIC
low complexity region 616 632 N/A INTRINSIC
ANK 655 684 2.25e-3 SMART
ANK 688 717 1.31e-4 SMART
SH3 757 815 4.66e-17 SMART
Meta Mutation Damage Score 0.476 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] IASPP is one of the most evolutionarily conserved inhibitors of p53 (TP53; MIM 191170), whereas ASPP1 (MIM 606455) and ASPP2 (MIM 602143) are activators of p53.[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygotes for spontaneous mutations in this gene exhibit cardiovascular defects leading to cardiomyopathy, open eyelids at birth, and coat abnormalities. One allele also shows postnatal lethality dependent on strain background and decreased weight, while another shows impaired fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004P03Rik T C 12: 17,007,184 D104G probably damaging Het
2810021J22Rik T C 11: 58,880,924 S411P probably damaging Het
Adcy2 T C 13: 68,727,905 R493G probably benign Het
Adcy8 A G 15: 64,737,438 I874T probably benign Het
Ano2 G T 6: 125,980,124 E619* probably null Het
Apob A G 12: 8,006,456 K1613R probably benign Het
Arhgef10 T A 8: 14,956,963 F476Y probably damaging Het
Bmf G A 2: 118,546,802 A74V probably damaging Het
Cadps T C 14: 12,467,139 E925G possibly damaging Het
Ccdc162 T C 10: 41,681,686 D181G possibly damaging Het
Ccdc85c A T 12: 108,207,175 C387S probably benign Het
Cntnap5a T C 1: 116,446,680 V974A possibly damaging Het
Dnah7b T C 1: 46,211,328 F1703S probably damaging Het
Dsg3 C A 18: 20,539,736 D821E probably benign Het
Ecel1 G T 1: 87,152,946 probably null Het
Edn1 A T 13: 42,305,253 probably null Het
Egfr G A 11: 16,858,980 C58Y probably damaging Het
Fam184a T C 10: 53,698,500 N282D probably benign Het
Fhit T A 14: 9,870,091 Q63L probably damaging Het
Gabarapl2 T C 8: 111,942,518 V36A probably benign Het
Glis1 T C 4: 107,567,645 V151A probably benign Het
Gm12695 A G 4: 96,761,980 S210P probably damaging Het
Gpat4 TAGAAGA TAGA 8: 23,182,849 probably benign Het
H2-M10.4 G A 17: 36,461,796 A98V probably benign Het
Hhat C A 1: 192,595,054 G366C probably damaging Het
Hydin C A 8: 110,462,522 A1186E probably damaging Het
Itgb2 T A 10: 77,550,103 probably null Het
Kank1 C T 19: 25,410,034 A329V possibly damaging Het
Kdm4b T A 17: 56,401,675 S1070T probably benign Het
Kyat1 A G 2: 30,188,265 Y101H probably damaging Het
Lman1l T A 9: 57,609,200 I407F probably damaging Het
Map4k5 T C 12: 69,811,366 K679R probably benign Het
Mill1 A T 7: 18,255,928 D45V probably damaging Het
Myo3a T A 2: 22,407,422 Y743N probably damaging Het
Nox4 C G 7: 87,297,508 I137M probably benign Het
Odf4 A G 11: 68,922,839 probably null Het
Ostf1 A T 19: 18,581,288 D210E probably damaging Het
Paxip1 A T 5: 27,761,677 probably null Het
Pitrm1 A G 13: 6,556,542 T211A probably benign Het
Pla2g4f A G 2: 120,305,015 S393P probably damaging Het
Plppr3 T C 10: 79,867,525 T42A probably damaging Het
Plxna4 C A 6: 32,165,844 G1559W probably damaging Het
Prex1 C T 2: 166,638,332 V163M probably damaging Het
Prl6a1 A G 13: 27,316,324 T93A probably benign Het
Psg16 T C 7: 17,090,534 V81A probably benign Het
Rbm33 A T 5: 28,408,282 probably benign Het
Rest C T 5: 77,275,243 P298L possibly damaging Het
Rhobtb3 G A 13: 75,878,932 R441* probably null Het
Rims4 T A 2: 163,864,994 K155* probably null Het
Rps6kb1 C T 11: 86,519,887 probably null Het
Ryr2 T C 13: 11,692,646 D2835G probably damaging Het
Sc5d C T 9: 42,258,650 V92I probably benign Het
Sell A T 1: 164,066,260 I175F probably damaging Het
Serpinb6d A G 13: 33,671,228 D295G probably damaging Het
Sphk1 A G 11: 116,535,280 D96G probably damaging Het
Spns3 A T 11: 72,537,270 V228D probably damaging Het
Sspo A G 6: 48,492,894 S4500G probably damaging Het
Syt9 T A 7: 107,436,471 C232S possibly damaging Het
Terf1 A G 1: 15,818,961 I176V possibly damaging Het
Tln2 C T 9: 67,302,572 A428T probably damaging Het
Tmprss7 T C 16: 45,679,348 N321S probably benign Het
Tomm40 A G 7: 19,701,836 I323T probably benign Het
Try5 T A 6: 41,311,299 Q240L possibly damaging Het
Vmn1r213 A T 13: 23,011,630 I128L probably benign Het
Vmn2r80 T C 10: 79,194,328 F663L possibly damaging Het
Znfx1 T A 2: 167,039,030 Y278F probably damaging Het
Zpbp2 A G 11: 98,551,291 probably benign Het
Other mutations in Ppp1r13l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01473:Ppp1r13l APN 7 19375268 missense probably damaging 1.00
IGL01800:Ppp1r13l APN 7 19378011 unclassified probably benign
IGL02714:Ppp1r13l APN 7 19377643 missense possibly damaging 0.93
IGL03251:Ppp1r13l APN 7 19368869 splice site probably benign
R0507:Ppp1r13l UTSW 7 19375814 missense possibly damaging 0.63
R1147:Ppp1r13l UTSW 7 19375847 missense probably damaging 1.00
R1147:Ppp1r13l UTSW 7 19375847 missense probably damaging 1.00
R1845:Ppp1r13l UTSW 7 19368611 missense probably damaging 0.97
R1885:Ppp1r13l UTSW 7 19377571 missense probably damaging 1.00
R1886:Ppp1r13l UTSW 7 19377571 missense probably damaging 1.00
R2118:Ppp1r13l UTSW 7 19371421 missense possibly damaging 0.89
R4063:Ppp1r13l UTSW 7 19370053 missense probably benign
R5121:Ppp1r13l UTSW 7 19370095 missense probably damaging 1.00
R5604:Ppp1r13l UTSW 7 19375599 missense possibly damaging 0.89
R5669:Ppp1r13l UTSW 7 19373022 missense probably benign 0.00
R5911:Ppp1r13l UTSW 7 19375892 critical splice donor site probably null
R6002:Ppp1r13l UTSW 7 19377970 missense probably benign 0.22
R6058:Ppp1r13l UTSW 7 19370575 missense probably benign 0.01
R6170:Ppp1r13l UTSW 7 19370437 missense probably benign 0.13
R6171:Ppp1r13l UTSW 7 19377511 missense probably benign 0.06
R6246:Ppp1r13l UTSW 7 19369858 missense probably benign 0.00
R6418:Ppp1r13l UTSW 7 19371331 missense probably damaging 1.00
R6845:Ppp1r13l UTSW 7 19371398 missense probably damaging 0.99
R7367:Ppp1r13l UTSW 7 19370156 missense probably benign 0.36
R7381:Ppp1r13l UTSW 7 19368861 critical splice donor site probably null
R7467:Ppp1r13l UTSW 7 19371380 missense probably damaging 0.99
R7510:Ppp1r13l UTSW 7 19368801 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- CTCCTTTGAGCTAGCTGTGG -3'
(R):5'- CGATGAGGAAGTCCACGATG -3'

Sequencing Primer
(F):5'- GCTGGTGTCGCTGAAGC -3'
(R):5'- CACGATGGGGTAGTTGGCAC -3'
Posted On2015-10-21