Incidental Mutation 'R4685:Arhgef10'
ID353607
Institutional Source Beutler Lab
Gene Symbol Arhgef10
Ensembl Gene ENSMUSG00000071176
Gene NameRho guanine nucleotide exchange factor (GEF) 10
Synonyms6430549H08Rik
MMRRC Submission 041936-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4685 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location14911663-15001085 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 14956963 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 476 (F476Y)
Ref Sequence ENSEMBL: ENSMUSP00000106424 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084207] [ENSMUST00000110800] [ENSMUST00000161162] [ENSMUST00000163062]
Predicted Effect probably damaging
Transcript: ENSMUST00000084207
AA Change: F515Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081225
Gene: ENSMUSG00000071176
AA Change: F515Y

DomainStartEndE-ValueType
low complexity region 73 82 N/A INTRINSIC
low complexity region 155 165 N/A INTRINSIC
low complexity region 236 245 N/A INTRINSIC
low complexity region 247 265 N/A INTRINSIC
coiled coil region 308 335 N/A INTRINSIC
RhoGEF 401 583 9.79e-58 SMART
Blast:PH 617 829 6e-47 BLAST
low complexity region 1256 1272 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110800
AA Change: F476Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106424
Gene: ENSMUSG00000071176
AA Change: F476Y

DomainStartEndE-ValueType
low complexity region 73 82 N/A INTRINSIC
low complexity region 155 165 N/A INTRINSIC
low complexity region 236 245 N/A INTRINSIC
low complexity region 247 265 N/A INTRINSIC
low complexity region 280 291 N/A INTRINSIC
RhoGEF 362 544 9.79e-58 SMART
Blast:PH 578 790 8e-47 BLAST
low complexity region 1217 1233 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161162
AA Change: F514Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125606
Gene: ENSMUSG00000071176
AA Change: F514Y

DomainStartEndE-ValueType
low complexity region 73 82 N/A INTRINSIC
low complexity region 155 165 N/A INTRINSIC
low complexity region 235 244 N/A INTRINSIC
low complexity region 246 264 N/A INTRINSIC
coiled coil region 307 334 N/A INTRINSIC
RhoGEF 400 579 2.2e-51 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162958
Predicted Effect probably damaging
Transcript: ENSMUST00000163062
AA Change: F187Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125526
Gene: ENSMUSG00000071176
AA Change: F187Y

DomainStartEndE-ValueType
RhoGEF 73 255 9.79e-58 SMART
Blast:PH 289 501 2e-47 BLAST
low complexity region 899 915 N/A INTRINSIC
Meta Mutation Damage Score 0.24 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Rho guanine nucleotide exchange factor (GEF). Rho GEFs regulate the activity of small Rho GTPases by stimulating the exchange of guanine diphosphate (GDP) for guanine triphosphate (GTP) and may play a role in neural morphogenesis. Mutations in this gene are associated with slowed nerve conduction velocity (SNCV). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004P03Rik T C 12: 17,007,184 D104G probably damaging Het
2810021J22Rik T C 11: 58,880,924 S411P probably damaging Het
Adcy2 T C 13: 68,727,905 R493G probably benign Het
Adcy8 A G 15: 64,737,438 I874T probably benign Het
Ano2 G T 6: 125,980,124 E619* probably null Het
Apob A G 12: 8,006,456 K1613R probably benign Het
Bmf G A 2: 118,546,802 A74V probably damaging Het
Cadps T C 14: 12,467,139 E925G possibly damaging Het
Ccdc162 T C 10: 41,681,686 D181G possibly damaging Het
Ccdc85c A T 12: 108,207,175 C387S probably benign Het
Cntnap5a T C 1: 116,446,680 V974A possibly damaging Het
Dnah7b T C 1: 46,211,328 F1703S probably damaging Het
Dsg3 C A 18: 20,539,736 D821E probably benign Het
Ecel1 G T 1: 87,152,946 probably null Het
Edn1 A T 13: 42,305,253 probably null Het
Egfr G A 11: 16,858,980 C58Y probably damaging Het
Fam184a T C 10: 53,698,500 N282D probably benign Het
Fhit T A 14: 9,870,091 Q63L probably damaging Het
Gabarapl2 T C 8: 111,942,518 V36A probably benign Het
Glis1 T C 4: 107,567,645 V151A probably benign Het
Gm12695 A G 4: 96,761,980 S210P probably damaging Het
Gpat4 TAGAAGA TAGA 8: 23,182,849 probably benign Het
H2-M10.4 G A 17: 36,461,796 A98V probably benign Het
Hhat C A 1: 192,595,054 G366C probably damaging Het
Hydin C A 8: 110,462,522 A1186E probably damaging Het
Itgb2 T A 10: 77,550,103 probably null Het
Kank1 C T 19: 25,410,034 A329V possibly damaging Het
Kdm4b T A 17: 56,401,675 S1070T probably benign Het
Kyat1 A G 2: 30,188,265 Y101H probably damaging Het
Lman1l T A 9: 57,609,200 I407F probably damaging Het
Map4k5 T C 12: 69,811,366 K679R probably benign Het
Mill1 A T 7: 18,255,928 D45V probably damaging Het
Myo3a T A 2: 22,407,422 Y743N probably damaging Het
Nox4 C G 7: 87,297,508 I137M probably benign Het
Odf4 A G 11: 68,922,839 probably null Het
Ostf1 A T 19: 18,581,288 D210E probably damaging Het
Paxip1 A T 5: 27,761,677 probably null Het
Pitrm1 A G 13: 6,556,542 T211A probably benign Het
Pla2g4f A G 2: 120,305,015 S393P probably damaging Het
Plppr3 T C 10: 79,867,525 T42A probably damaging Het
Plxna4 C A 6: 32,165,844 G1559W probably damaging Het
Ppp1r13l T C 7: 19,375,383 probably null Het
Prex1 C T 2: 166,638,332 V163M probably damaging Het
Prl6a1 A G 13: 27,316,324 T93A probably benign Het
Psg16 T C 7: 17,090,534 V81A probably benign Het
Rbm33 A T 5: 28,408,282 probably benign Het
Rest C T 5: 77,275,243 P298L possibly damaging Het
Rhobtb3 G A 13: 75,878,932 R441* probably null Het
Rims4 T A 2: 163,864,994 K155* probably null Het
Rps6kb1 C T 11: 86,519,887 probably null Het
Ryr2 T C 13: 11,692,646 D2835G probably damaging Het
Sc5d C T 9: 42,258,650 V92I probably benign Het
Sell A T 1: 164,066,260 I175F probably damaging Het
Serpinb6d A G 13: 33,671,228 D295G probably damaging Het
Sphk1 A G 11: 116,535,280 D96G probably damaging Het
Spns3 A T 11: 72,537,270 V228D probably damaging Het
Sspo A G 6: 48,492,894 S4500G probably damaging Het
Syt9 T A 7: 107,436,471 C232S possibly damaging Het
Terf1 A G 1: 15,818,961 I176V possibly damaging Het
Tln2 C T 9: 67,302,572 A428T probably damaging Het
Tmprss7 T C 16: 45,679,348 N321S probably benign Het
Tomm40 A G 7: 19,701,836 I323T probably benign Het
Try5 T A 6: 41,311,299 Q240L possibly damaging Het
Vmn1r213 A T 13: 23,011,630 I128L probably benign Het
Vmn2r80 T C 10: 79,194,328 F663L possibly damaging Het
Znfx1 T A 2: 167,039,030 Y278F probably damaging Het
Zpbp2 A G 11: 98,551,291 probably benign Het
Other mutations in Arhgef10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00766:Arhgef10 APN 8 14975006 missense probably damaging 1.00
IGL00823:Arhgef10 APN 8 14940378 unclassified probably benign
IGL01012:Arhgef10 APN 8 14979977 missense probably damaging 0.99
IGL01311:Arhgef10 APN 8 14991054 splice site probably null
IGL01596:Arhgef10 APN 8 14999468 nonsense probably null
IGL01888:Arhgef10 APN 8 14962577 nonsense probably null
IGL01938:Arhgef10 APN 8 14991062 missense probably benign 0.09
IGL02151:Arhgef10 APN 8 14928889 missense possibly damaging 0.77
IGL02274:Arhgef10 APN 8 14947205 missense probably damaging 0.99
IGL02369:Arhgef10 APN 8 14997551 missense probably damaging 1.00
IGL02411:Arhgef10 APN 8 14954819 missense probably benign 0.01
IGL02500:Arhgef10 APN 8 14961238 missense probably damaging 1.00
IGL02597:Arhgef10 APN 8 14930198 missense probably benign 0.27
IGL02602:Arhgef10 APN 8 14930198 missense probably benign 0.27
IGL02743:Arhgef10 APN 8 14930198 missense probably benign 0.27
IGL02744:Arhgef10 APN 8 14930198 missense probably benign 0.27
IGL03113:Arhgef10 APN 8 14954505 missense probably damaging 1.00
IGL03248:Arhgef10 APN 8 14928847 missense probably benign 0.00
P0028:Arhgef10 UTSW 8 14928925 missense possibly damaging 0.79
P4748:Arhgef10 UTSW 8 14928925 missense possibly damaging 0.79
R0049:Arhgef10 UTSW 8 14954446 missense probably damaging 1.00
R0197:Arhgef10 UTSW 8 14962636 missense probably damaging 1.00
R0479:Arhgef10 UTSW 8 14991070 missense probably damaging 0.98
R0701:Arhgef10 UTSW 8 14962636 missense probably damaging 1.00
R0966:Arhgef10 UTSW 8 14940343 missense probably benign 0.01
R1367:Arhgef10 UTSW 8 14940225 missense probably damaging 1.00
R1572:Arhgef10 UTSW 8 14991211 missense possibly damaging 0.53
R1631:Arhgef10 UTSW 8 14947157 missense probably damaging 0.98
R1766:Arhgef10 UTSW 8 14979836 missense probably damaging 1.00
R1920:Arhgef10 UTSW 8 14956987 splice site probably benign
R2051:Arhgef10 UTSW 8 14945320 missense probably null 1.00
R2088:Arhgef10 UTSW 8 14983898 missense possibly damaging 0.46
R2118:Arhgef10 UTSW 8 14934820 missense probably damaging 0.99
R2120:Arhgef10 UTSW 8 14934820 missense probably damaging 0.99
R2121:Arhgef10 UTSW 8 14934820 missense probably damaging 0.99
R2122:Arhgef10 UTSW 8 14934820 missense probably damaging 0.99
R2124:Arhgef10 UTSW 8 14934820 missense probably damaging 0.99
R2318:Arhgef10 UTSW 8 14928855 missense probably damaging 1.00
R2870:Arhgef10 UTSW 8 14975093 critical splice donor site probably null
R2870:Arhgef10 UTSW 8 14975666 missense probably benign 0.01
R2870:Arhgef10 UTSW 8 14975093 critical splice donor site probably null
R2870:Arhgef10 UTSW 8 14975666 missense probably benign 0.01
R2872:Arhgef10 UTSW 8 14975093 critical splice donor site probably null
R2872:Arhgef10 UTSW 8 14975666 missense probably benign 0.01
R2872:Arhgef10 UTSW 8 14975093 critical splice donor site probably null
R2872:Arhgef10 UTSW 8 14975666 missense probably benign 0.01
R2874:Arhgef10 UTSW 8 14975093 critical splice donor site probably null
R2874:Arhgef10 UTSW 8 14975666 missense probably benign 0.01
R3522:Arhgef10 UTSW 8 14954918 missense probably damaging 1.00
R4049:Arhgef10 UTSW 8 14979998 missense probably benign 0.05
R4324:Arhgef10 UTSW 8 14940335 missense possibly damaging 0.77
R4351:Arhgef10 UTSW 8 14991145 nonsense probably null
R4384:Arhgef10 UTSW 8 14930157 nonsense probably null
R4385:Arhgef10 UTSW 8 14930157 nonsense probably null
R5111:Arhgef10 UTSW 8 14932408 missense probably benign 0.00
R5169:Arhgef10 UTSW 8 14930051 missense possibly damaging 0.80
R5670:Arhgef10 UTSW 8 14954774 missense probably benign 0.01
R5945:Arhgef10 UTSW 8 14980028 critical splice donor site probably null
R6593:Arhgef10 UTSW 8 14962522 missense probably damaging 1.00
R6593:Arhgef10 UTSW 8 14962564 missense possibly damaging 0.82
R6734:Arhgef10 UTSW 8 14975053 missense probably damaging 1.00
R6859:Arhgef10 UTSW 8 14975005 missense probably damaging 1.00
R6890:Arhgef10 UTSW 8 14928786 missense probably benign 0.27
R7068:Arhgef10 UTSW 8 14958639 missense probably damaging 1.00
R7081:Arhgef10 UTSW 8 14997547 nonsense probably null
R7157:Arhgef10 UTSW 8 14930030 missense probably damaging 1.00
R7232:Arhgef10 UTSW 8 14940323 missense probably benign 0.10
R7514:Arhgef10 UTSW 8 14975956 missense probably benign 0.16
R7544:Arhgef10 UTSW 8 14979854 missense probably benign 0.34
X0024:Arhgef10 UTSW 8 14978486 missense probably benign 0.01
X0027:Arhgef10 UTSW 8 14997631 missense possibly damaging 0.92
Z1088:Arhgef10 UTSW 8 14964191 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAAGAGCTCCTGCAGTCATAG -3'
(R):5'- TCTATGATCCAGCCTAGAGCC -3'

Sequencing Primer
(F):5'- TCCTGCAGTCATAGCCGTCG -3'
(R):5'- TCCCCTCGTCGACACAG -3'
Posted On2015-10-21