Incidental Mutation 'R4685:Rps6kb1'
ID353622
Institutional Source Beutler Lab
Gene Symbol Rps6kb1
Ensembl Gene ENSMUSG00000020516
Gene Nameribosomal protein S6 kinase, polypeptide 1
Synonymsp70s6k, 2610318I15Rik, S6K1, p70/85s6k
MMRRC Submission 041936-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.948) question?
Stock #R4685 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location86498871-86544805 bp(-) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) C to T at 86519887 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119715 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058286] [ENSMUST00000154617]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000020824
Predicted Effect probably null
Transcript: ENSMUST00000058286
SMART Domains Protein: ENSMUSP00000053188
Gene: ENSMUSG00000020516

DomainStartEndE-ValueType
Pfam:Pkinase 91 202 1.2e-19 PFAM
Pfam:Pkinase_Tyr 91 253 5.9e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131194
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151748
Predicted Effect probably null
Transcript: ENSMUST00000154617
SMART Domains Protein: ENSMUSP00000119715
Gene: ENSMUSG00000020516

DomainStartEndE-ValueType
S_TKc 91 352 8.24e-107 SMART
S_TK_X 353 415 9.2e-27 SMART
Meta Mutation Damage Score 0.62 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ribosomal S6 kinase family of serine/threonine kinases. The encoded protein responds to mTOR (mammalian target of rapamycin) signaling to promote protein synthesis, cell growth, and cell proliferation. Activity of this gene has been associated with human cancer. Alternatively spliced transcript variants have been observed. The use of alternative translation start sites results in isoforms with longer or shorter N-termini which may differ in their subcellular localizations. There are two pseudogenes for this gene on chromosome 17. [provided by RefSeq, Jan 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced prenatal growth, glucose intolerance, and hypoinsulinemia associated with diminished pancreatic beta cell size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004P03Rik T C 12: 17,007,184 D104G probably damaging Het
2810021J22Rik T C 11: 58,880,924 S411P probably damaging Het
Adcy2 T C 13: 68,727,905 R493G probably benign Het
Adcy8 A G 15: 64,737,438 I874T probably benign Het
Ano2 G T 6: 125,980,124 E619* probably null Het
Apob A G 12: 8,006,456 K1613R probably benign Het
Arhgef10 T A 8: 14,956,963 F476Y probably damaging Het
Bmf G A 2: 118,546,802 A74V probably damaging Het
Cadps T C 14: 12,467,139 E925G possibly damaging Het
Ccdc162 T C 10: 41,681,686 D181G possibly damaging Het
Ccdc85c A T 12: 108,207,175 C387S probably benign Het
Cntnap5a T C 1: 116,446,680 V974A possibly damaging Het
Dnah7b T C 1: 46,211,328 F1703S probably damaging Het
Dsg3 C A 18: 20,539,736 D821E probably benign Het
Ecel1 G T 1: 87,152,946 probably null Het
Edn1 A T 13: 42,305,253 probably null Het
Egfr G A 11: 16,858,980 C58Y probably damaging Het
Fam184a T C 10: 53,698,500 N282D probably benign Het
Fhit T A 14: 9,870,091 Q63L probably damaging Het
Gabarapl2 T C 8: 111,942,518 V36A probably benign Het
Glis1 T C 4: 107,567,645 V151A probably benign Het
Gm12695 A G 4: 96,761,980 S210P probably damaging Het
Gpat4 TAGAAGA TAGA 8: 23,182,849 probably benign Het
H2-M10.4 G A 17: 36,461,796 A98V probably benign Het
Hhat C A 1: 192,595,054 G366C probably damaging Het
Hydin C A 8: 110,462,522 A1186E probably damaging Het
Itgb2 T A 10: 77,550,103 probably null Het
Kank1 C T 19: 25,410,034 A329V possibly damaging Het
Kdm4b T A 17: 56,401,675 S1070T probably benign Het
Kyat1 A G 2: 30,188,265 Y101H probably damaging Het
Lman1l T A 9: 57,609,200 I407F probably damaging Het
Map4k5 T C 12: 69,811,366 K679R probably benign Het
Mill1 A T 7: 18,255,928 D45V probably damaging Het
Myo3a T A 2: 22,407,422 Y743N probably damaging Het
Nox4 C G 7: 87,297,508 I137M probably benign Het
Odf4 A G 11: 68,922,839 probably null Het
Ostf1 A T 19: 18,581,288 D210E probably damaging Het
Paxip1 A T 5: 27,761,677 probably null Het
Pitrm1 A G 13: 6,556,542 T211A probably benign Het
Pla2g4f A G 2: 120,305,015 S393P probably damaging Het
Plppr3 T C 10: 79,867,525 T42A probably damaging Het
Plxna4 C A 6: 32,165,844 G1559W probably damaging Het
Ppp1r13l T C 7: 19,375,383 probably null Het
Prex1 C T 2: 166,638,332 V163M probably damaging Het
Prl6a1 A G 13: 27,316,324 T93A probably benign Het
Psg16 T C 7: 17,090,534 V81A probably benign Het
Rbm33 A T 5: 28,408,282 probably benign Het
Rest C T 5: 77,275,243 P298L possibly damaging Het
Rhobtb3 G A 13: 75,878,932 R441* probably null Het
Rims4 T A 2: 163,864,994 K155* probably null Het
Ryr2 T C 13: 11,692,646 D2835G probably damaging Het
Sc5d C T 9: 42,258,650 V92I probably benign Het
Sell A T 1: 164,066,260 I175F probably damaging Het
Serpinb6d A G 13: 33,671,228 D295G probably damaging Het
Sphk1 A G 11: 116,535,280 D96G probably damaging Het
Spns3 A T 11: 72,537,270 V228D probably damaging Het
Sspo A G 6: 48,492,894 S4500G probably damaging Het
Syt9 T A 7: 107,436,471 C232S possibly damaging Het
Terf1 A G 1: 15,818,961 I176V possibly damaging Het
Tln2 C T 9: 67,302,572 A428T probably damaging Het
Tmprss7 T C 16: 45,679,348 N321S probably benign Het
Tomm40 A G 7: 19,701,836 I323T probably benign Het
Try5 T A 6: 41,311,299 Q240L possibly damaging Het
Vmn1r213 A T 13: 23,011,630 I128L probably benign Het
Vmn2r80 T C 10: 79,194,328 F663L possibly damaging Het
Znfx1 T A 2: 167,039,030 Y278F probably damaging Het
Zpbp2 A G 11: 98,551,291 probably benign Het
Other mutations in Rps6kb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01010:Rps6kb1 APN 11 86502766 missense probably benign
IGL02707:Rps6kb1 APN 11 86535410 critical splice donor site probably null
IGL03101:Rps6kb1 APN 11 86502882 missense probably benign 0.23
IGL03331:Rps6kb1 APN 11 86532830 missense probably damaging 1.00
R0025:Rps6kb1 UTSW 11 86511587 critical splice donor site probably null
R1797:Rps6kb1 UTSW 11 86502808 nonsense probably null
R1931:Rps6kb1 UTSW 11 86532821 missense possibly damaging 0.52
R2214:Rps6kb1 UTSW 11 86534070 missense possibly damaging 0.71
R3196:Rps6kb1 UTSW 11 86506807 missense probably benign 0.01
R3699:Rps6kb1 UTSW 11 86532794 missense probably damaging 1.00
R4171:Rps6kb1 UTSW 11 86544579 missense possibly damaging 0.68
R4291:Rps6kb1 UTSW 11 86519876 intron probably benign
R4727:Rps6kb1 UTSW 11 86544658 unclassified probably null
R4728:Rps6kb1 UTSW 11 86544658 unclassified probably null
R5450:Rps6kb1 UTSW 11 86532837 missense probably damaging 1.00
R5648:Rps6kb1 UTSW 11 86512871 missense possibly damaging 0.54
R5796:Rps6kb1 UTSW 11 86511851 missense probably benign 0.26
R5955:Rps6kb1 UTSW 11 86513605 missense probably damaging 1.00
R7080:Rps6kb1 UTSW 11 86506840 missense probably damaging 1.00
R7450:Rps6kb1 UTSW 11 86502831 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- GGTGGATTACAATAGATAACCCAGC -3'
(R):5'- GAGTAGCCTCCATTACCCTCAC -3'

Sequencing Primer
(F):5'- AACCCAGCTTATTACTGTGTTAATAC -3'
(R):5'- CCAGTTACCATAGGATCAAAATGTTG -3'
Posted On2015-10-21