Incidental Mutation 'R4685:Ccdc85c'
ID353629
Institutional Source Beutler Lab
Gene Symbol Ccdc85c
Ensembl Gene ENSMUSG00000084883
Gene Namecoiled-coil domain containing 85C
SynonymsGm9010
MMRRC Submission 041936-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.354) question?
Stock #R4685 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location108203602-108275425 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 108207175 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 387 (C387S)
Ref Sequence ENSEMBL: ENSMUSP00000125757 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101055] [ENSMUST00000136175] [ENSMUST00000221167] [ENSMUST00000222310]
Predicted Effect probably benign
Transcript: ENSMUST00000101055
SMART Domains Protein: ENSMUSP00000098616
Gene: ENSMUSG00000021258

DomainStartEndE-ValueType
CYCLIN 55 149 6.67e-16 SMART
Cyclin_C 158 278 4.83e-1 SMART
CYCLIN 162 256 1.23e-1 SMART
low complexity region 342 361 N/A INTRINSIC
low complexity region 365 392 N/A INTRINSIC
low complexity region 404 427 N/A INTRINSIC
low complexity region 428 446 N/A INTRINSIC
low complexity region 457 471 N/A INTRINSIC
low complexity region 476 576 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136175
AA Change: C387S

PolyPhen 2 Score 0.333 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000125757
Gene: ENSMUSG00000084883
AA Change: C387S

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
Pfam:DUF2216 16 220 6.9e-99 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000221167
Predicted Effect probably benign
Transcript: ENSMUST00000222310
AA Change: C374S

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
Meta Mutation Damage Score 0.102 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 97% (71/73)
MGI Phenotype PHENOTYPE: Homozygous mutant mice display hydrocephalus, intracranial hemorrhage due to ventricular dilatation, and heterotopia in the subcortical regions. Hydroencephaly usually becomes evident before 15 weeks of age and affected animals die within several days after notice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004P03Rik T C 12: 17,007,184 D104G probably damaging Het
2810021J22Rik T C 11: 58,880,924 S411P probably damaging Het
Adcy2 T C 13: 68,727,905 R493G probably benign Het
Adcy8 A G 15: 64,737,438 I874T probably benign Het
Ano2 G T 6: 125,980,124 E619* probably null Het
Apob A G 12: 8,006,456 K1613R probably benign Het
Arhgef10 T A 8: 14,956,963 F476Y probably damaging Het
Bmf G A 2: 118,546,802 A74V probably damaging Het
Cadps T C 14: 12,467,139 E925G possibly damaging Het
Ccdc162 T C 10: 41,681,686 D181G possibly damaging Het
Cntnap5a T C 1: 116,446,680 V974A possibly damaging Het
Dnah7b T C 1: 46,211,328 F1703S probably damaging Het
Dsg3 C A 18: 20,539,736 D821E probably benign Het
Ecel1 G T 1: 87,152,946 probably null Het
Edn1 A T 13: 42,305,253 probably null Het
Egfr G A 11: 16,858,980 C58Y probably damaging Het
Fam184a T C 10: 53,698,500 N282D probably benign Het
Fhit T A 14: 9,870,091 Q63L probably damaging Het
Gabarapl2 T C 8: 111,942,518 V36A probably benign Het
Glis1 T C 4: 107,567,645 V151A probably benign Het
Gm12695 A G 4: 96,761,980 S210P probably damaging Het
Gpat4 TAGAAGA TAGA 8: 23,182,849 probably benign Het
H2-M10.4 G A 17: 36,461,796 A98V probably benign Het
Hhat C A 1: 192,595,054 G366C probably damaging Het
Hydin C A 8: 110,462,522 A1186E probably damaging Het
Itgb2 T A 10: 77,550,103 probably null Het
Kank1 C T 19: 25,410,034 A329V possibly damaging Het
Kdm4b T A 17: 56,401,675 S1070T probably benign Het
Kyat1 A G 2: 30,188,265 Y101H probably damaging Het
Lman1l T A 9: 57,609,200 I407F probably damaging Het
Map4k5 T C 12: 69,811,366 K679R probably benign Het
Mill1 A T 7: 18,255,928 D45V probably damaging Het
Myo3a T A 2: 22,407,422 Y743N probably damaging Het
Nox4 C G 7: 87,297,508 I137M probably benign Het
Odf4 A G 11: 68,922,839 probably null Het
Ostf1 A T 19: 18,581,288 D210E probably damaging Het
Paxip1 A T 5: 27,761,677 probably null Het
Pitrm1 A G 13: 6,556,542 T211A probably benign Het
Pla2g4f A G 2: 120,305,015 S393P probably damaging Het
Plppr3 T C 10: 79,867,525 T42A probably damaging Het
Plxna4 C A 6: 32,165,844 G1559W probably damaging Het
Ppp1r13l T C 7: 19,375,383 probably null Het
Prex1 C T 2: 166,638,332 V163M probably damaging Het
Prl6a1 A G 13: 27,316,324 T93A probably benign Het
Psg16 T C 7: 17,090,534 V81A probably benign Het
Rbm33 A T 5: 28,408,282 probably benign Het
Rest C T 5: 77,275,243 P298L possibly damaging Het
Rhobtb3 G A 13: 75,878,932 R441* probably null Het
Rims4 T A 2: 163,864,994 K155* probably null Het
Rps6kb1 C T 11: 86,519,887 probably null Het
Ryr2 T C 13: 11,692,646 D2835G probably damaging Het
Sc5d C T 9: 42,258,650 V92I probably benign Het
Sell A T 1: 164,066,260 I175F probably damaging Het
Serpinb6d A G 13: 33,671,228 D295G probably damaging Het
Sphk1 A G 11: 116,535,280 D96G probably damaging Het
Spns3 A T 11: 72,537,270 V228D probably damaging Het
Sspo A G 6: 48,492,894 S4500G probably damaging Het
Syt9 T A 7: 107,436,471 C232S possibly damaging Het
Terf1 A G 1: 15,818,961 I176V possibly damaging Het
Tln2 C T 9: 67,302,572 A428T probably damaging Het
Tmprss7 T C 16: 45,679,348 N321S probably benign Het
Tomm40 A G 7: 19,701,836 I323T probably benign Het
Try5 T A 6: 41,311,299 Q240L possibly damaging Het
Vmn1r213 A T 13: 23,011,630 I128L probably benign Het
Vmn2r80 T C 10: 79,194,328 F663L possibly damaging Het
Znfx1 T A 2: 167,039,030 Y278F probably damaging Het
Zpbp2 A G 11: 98,551,291 probably benign Het
Other mutations in Ccdc85c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01916:Ccdc85c APN 12 108207844 missense probably damaging 1.00
IGL02061:Ccdc85c APN 12 108221743 missense probably damaging 1.00
IGL02316:Ccdc85c APN 12 108211570 missense probably damaging 1.00
IGL02516:Ccdc85c APN 12 108274901 missense unknown
IGL03146:Ccdc85c APN 12 108207136 nonsense probably null
FR4304:Ccdc85c UTSW 12 108274612 small insertion probably benign
FR4449:Ccdc85c UTSW 12 108274616 small insertion probably benign
R5048:Ccdc85c UTSW 12 108221707 critical splice donor site probably null
R5516:Ccdc85c UTSW 12 108207850 missense probably damaging 1.00
R5588:Ccdc85c UTSW 12 108211534 missense probably damaging 1.00
R6054:Ccdc85c UTSW 12 108274769 missense unknown
R6318:Ccdc85c UTSW 12 108274709 missense unknown
Predicted Primers PCR Primer
(F):5'- CATAGCTAAGCCAGTGAGAAGC -3'
(R):5'- TTGTGCAGGGACACTCAGTC -3'

Sequencing Primer
(F):5'- AAGCAGGTGGCCACATTC -3'
(R):5'- AGTGACTGCCGTGTCCAAC -3'
Posted On2015-10-21