Incidental Mutation 'R4685:Edn1'
ID353634
Institutional Source Beutler Lab
Gene Symbol Edn1
Ensembl Gene ENSMUSG00000021367
Gene Nameendothelin 1
SynonymsET-1
MMRRC Submission 041936-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4685 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location42301476-42307990 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to T at 42305253 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000021796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021796]
Predicted Effect probably null
Transcript: ENSMUST00000021796
SMART Domains Protein: ENSMUSP00000021796
Gene: ENSMUSG00000021367

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
END 52 73 4.45e-11 SMART
low complexity region 84 99 N/A INTRINSIC
END 109 130 1.95e-7 SMART
low complexity region 143 156 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221433
Meta Mutation Damage Score 0.444 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 97% (71/73)
MGI Phenotype FUNCTION: This gene encodes a member of the endothelin family of peptides. The encoded preproprotein undergoes proteolytic processing to generate a peptide before secretion by the vascular endothelial cells. The mature peptide has various biological activities such as vasoconstriction, cell proliferation, stimulation of hormone release and modulation of central nervous activity. Mice lacking the encoded protein exhibit neonatal lethality accompanied with numerous craniofacial and cardiovascular defects due to disruption in cranial and cardiac neural crest cell patterning during early embryogenesis. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit cardiovascular malformations, craniofacial abnormalities, and lethality due to respiratory failure at birth. Heterozygotes develop elevated arterial blood pressure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004P03Rik T C 12: 17,007,184 D104G probably damaging Het
2810021J22Rik T C 11: 58,880,924 S411P probably damaging Het
Adcy2 T C 13: 68,727,905 R493G probably benign Het
Adcy8 A G 15: 64,737,438 I874T probably benign Het
Ano2 G T 6: 125,980,124 E619* probably null Het
Apob A G 12: 8,006,456 K1613R probably benign Het
Arhgef10 T A 8: 14,956,963 F476Y probably damaging Het
Bmf G A 2: 118,546,802 A74V probably damaging Het
Cadps T C 14: 12,467,139 E925G possibly damaging Het
Ccdc162 T C 10: 41,681,686 D181G possibly damaging Het
Ccdc85c A T 12: 108,207,175 C387S probably benign Het
Cntnap5a T C 1: 116,446,680 V974A possibly damaging Het
Dnah7b T C 1: 46,211,328 F1703S probably damaging Het
Dsg3 C A 18: 20,539,736 D821E probably benign Het
Ecel1 G T 1: 87,152,946 probably null Het
Egfr G A 11: 16,858,980 C58Y probably damaging Het
Fam184a T C 10: 53,698,500 N282D probably benign Het
Fhit T A 14: 9,870,091 Q63L probably damaging Het
Gabarapl2 T C 8: 111,942,518 V36A probably benign Het
Glis1 T C 4: 107,567,645 V151A probably benign Het
Gm12695 A G 4: 96,761,980 S210P probably damaging Het
Gpat4 TAGAAGA TAGA 8: 23,182,849 probably benign Het
H2-M10.4 G A 17: 36,461,796 A98V probably benign Het
Hhat C A 1: 192,595,054 G366C probably damaging Het
Hydin C A 8: 110,462,522 A1186E probably damaging Het
Itgb2 T A 10: 77,550,103 probably null Het
Kank1 C T 19: 25,410,034 A329V possibly damaging Het
Kdm4b T A 17: 56,401,675 S1070T probably benign Het
Kyat1 A G 2: 30,188,265 Y101H probably damaging Het
Lman1l T A 9: 57,609,200 I407F probably damaging Het
Map4k5 T C 12: 69,811,366 K679R probably benign Het
Mill1 A T 7: 18,255,928 D45V probably damaging Het
Myo3a T A 2: 22,407,422 Y743N probably damaging Het
Nox4 C G 7: 87,297,508 I137M probably benign Het
Odf4 A G 11: 68,922,839 probably null Het
Ostf1 A T 19: 18,581,288 D210E probably damaging Het
Paxip1 A T 5: 27,761,677 probably null Het
Pitrm1 A G 13: 6,556,542 T211A probably benign Het
Pla2g4f A G 2: 120,305,015 S393P probably damaging Het
Plppr3 T C 10: 79,867,525 T42A probably damaging Het
Plxna4 C A 6: 32,165,844 G1559W probably damaging Het
Ppp1r13l T C 7: 19,375,383 probably null Het
Prex1 C T 2: 166,638,332 V163M probably damaging Het
Prl6a1 A G 13: 27,316,324 T93A probably benign Het
Psg16 T C 7: 17,090,534 V81A probably benign Het
Rbm33 A T 5: 28,408,282 probably benign Het
Rest C T 5: 77,275,243 P298L possibly damaging Het
Rhobtb3 G A 13: 75,878,932 R441* probably null Het
Rims4 T A 2: 163,864,994 K155* probably null Het
Rps6kb1 C T 11: 86,519,887 probably null Het
Ryr2 T C 13: 11,692,646 D2835G probably damaging Het
Sc5d C T 9: 42,258,650 V92I probably benign Het
Sell A T 1: 164,066,260 I175F probably damaging Het
Serpinb6d A G 13: 33,671,228 D295G probably damaging Het
Sphk1 A G 11: 116,535,280 D96G probably damaging Het
Spns3 A T 11: 72,537,270 V228D probably damaging Het
Sspo A G 6: 48,492,894 S4500G probably damaging Het
Syt9 T A 7: 107,436,471 C232S possibly damaging Het
Terf1 A G 1: 15,818,961 I176V possibly damaging Het
Tln2 C T 9: 67,302,572 A428T probably damaging Het
Tmprss7 T C 16: 45,679,348 N321S probably benign Het
Tomm40 A G 7: 19,701,836 I323T probably benign Het
Try5 T A 6: 41,311,299 Q240L possibly damaging Het
Vmn1r213 A T 13: 23,011,630 I128L probably benign Het
Vmn2r80 T C 10: 79,194,328 F663L possibly damaging Het
Znfx1 T A 2: 167,039,030 Y278F probably damaging Het
Zpbp2 A G 11: 98,551,291 probably benign Het
Other mutations in Edn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01092:Edn1 APN 13 42303671 missense probably damaging 1.00
IGL01714:Edn1 APN 13 42305014 missense probably benign
IGL03106:Edn1 APN 13 42305023 missense possibly damaging 0.46
R0121:Edn1 UTSW 13 42305265 missense probably benign 0.04
R0522:Edn1 UTSW 13 42304954 missense probably damaging 0.99
R0646:Edn1 UTSW 13 42305242 splice site probably benign
R1720:Edn1 UTSW 13 42305350 missense probably benign 0.39
R1752:Edn1 UTSW 13 42303599 missense possibly damaging 0.48
R1807:Edn1 UTSW 13 42306794 missense probably damaging 1.00
R3883:Edn1 UTSW 13 42301906 missense probably benign 0.02
R4812:Edn1 UTSW 13 42303640 missense probably benign 0.17
R5071:Edn1 UTSW 13 42303677 missense probably damaging 1.00
R5154:Edn1 UTSW 13 42305023 missense probably benign 0.01
R5520:Edn1 UTSW 13 42301960 critical splice donor site probably null
R5708:Edn1 UTSW 13 42303667 missense probably benign 0.00
R5801:Edn1 UTSW 13 42306806 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- TGCTGGAATTTCTGCCAAGC -3'
(R):5'- ACCATGACGACTCTATTACTGGAC -3'

Sequencing Primer
(F):5'- TGCCAAGCAGGAAAAGAACTC -3'
(R):5'- TTTCTCCCACTAGAAAGGACTGGG -3'
Posted On2015-10-21