Incidental Mutation 'R4686:Akap6'
ID353690
Institutional Source Beutler Lab
Gene Symbol Akap6
Ensembl Gene ENSMUSG00000061603
Gene NameA kinase (PRKA) anchor protein 6
Synonyms
MMRRC Submission 041937-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.739) question?
Stock #R4686 (G1)
Quality Score217
Status Validated
Chromosome12
Chromosomal Location52699383-53155599 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) CA to C at 52887623 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095737] [ENSMUST00000219786]
Predicted Effect probably null
Transcript: ENSMUST00000095737
SMART Domains Protein: ENSMUSP00000093406
Gene: ENSMUSG00000061603

DomainStartEndE-ValueType
low complexity region 34 51 N/A INTRINSIC
Blast:SPEC 66 168 2e-50 BLAST
low complexity region 441 455 N/A INTRINSIC
low complexity region 544 555 N/A INTRINSIC
low complexity region 569 587 N/A INTRINSIC
low complexity region 640 651 N/A INTRINSIC
low complexity region 694 708 N/A INTRINSIC
SPEC 779 880 1.06e-1 SMART
SPEC 959 1057 1.45e0 SMART
SPEC 1078 1185 2.56e-2 SMART
low complexity region 1316 1332 N/A INTRINSIC
low complexity region 1555 1568 N/A INTRINSIC
low complexity region 1610 1622 N/A INTRINSIC
low complexity region 1683 1698 N/A INTRINSIC
low complexity region 1737 1781 N/A INTRINSIC
low complexity region 1899 1910 N/A INTRINSIC
low complexity region 2019 2031 N/A INTRINSIC
low complexity region 2104 2115 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000219786
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins, which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. The encoded protein is highly expressed in various brain regions and cardiac and skeletal muscle. It is specifically localized to the sarcoplasmic reticulum and nuclear membrane, and is involved in anchoring PKA to the nuclear membrane or sarcoplasmic reticulum. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted disruption of this gene results in partial embryonic lethality; surviving homozygotes display a decreased body weight, craniofacial defects and reduced viability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl2 A G 2: 27,093,825 N411S probably damaging Het
Adnp A C 2: 168,182,389 C995W possibly damaging Het
Ano2 T G 6: 125,790,291 I228M probably benign Het
Arhgap21 T C 2: 20,863,222 D830G probably damaging Het
Atp13a2 G A 4: 141,003,276 probably null Het
Ccdc175 C T 12: 72,112,278 S629N probably damaging Het
Cdhr4 T C 9: 107,995,684 W311R probably benign Het
Chaf1b A G 16: 93,884,584 H30R probably benign Het
Clnk G A 5: 38,741,837 probably benign Het
Copb1 A G 7: 114,221,736 S773P possibly damaging Het
Cse1l A G 2: 166,932,160 D198G probably damaging Het
Ears2 A G 7: 122,048,204 S286P probably damaging Het
Efcab7 A G 4: 99,878,116 E114G probably benign Het
Fanca G C 8: 123,268,934 probably benign Het
Flt3 A G 5: 147,377,048 L64P probably damaging Het
Gabrb1 A G 5: 71,700,022 T3A possibly damaging Het
Gm10384 T C 15: 36,871,653 noncoding transcript Het
Gm5117 G A 8: 31,739,256 noncoding transcript Het
Gpr141 T A 13: 19,751,781 I275F probably benign Het
Greb1l A T 18: 10,522,112 E736V probably damaging Het
Hc T C 2: 35,039,248 E279G possibly damaging Het
Hivep1 C T 13: 42,155,850 T522M probably benign Het
Hspa12a T A 19: 58,799,749 E547V possibly damaging Het
Il10ra A G 9: 45,269,059 L5S probably damaging Het
Iqcf6 G T 9: 106,627,344 W69L probably damaging Het
Iqgap2 T C 13: 95,721,609 N379S probably damaging Het
Itpr2 A G 6: 146,229,775 I1977T probably damaging Het
Kcnq1 A T 7: 143,107,729 Y124F probably benign Het
Lamp5 C T 2: 136,059,003 T41M probably damaging Het
Lgr5 A G 10: 115,458,743 probably benign Het
Mlec A G 5: 115,150,296 I167T possibly damaging Het
Myf6 A G 10: 107,493,828 V198A probably benign Het
Nceh1 C T 3: 27,241,669 R360C probably damaging Het
Nos2 C A 11: 78,928,630 T56N possibly damaging Het
Npw T G 17: 24,657,412 H175P probably benign Het
Nrxn3 A T 12: 89,510,651 I899F probably damaging Het
Ociad1 A G 5: 73,306,735 T179A possibly damaging Het
Olfr378 A G 11: 73,425,438 S182P probably benign Het
Olfr547 A G 7: 102,535,149 Y134C probably damaging Het
Olfr912 T A 9: 38,582,031 F251L probably damaging Het
Pacsin2 T C 15: 83,381,775 N74D probably benign Het
Pcdh7 A G 5: 58,129,169 I1196V probably benign Het
Pdxk A T 10: 78,447,003 probably null Het
Phb2 G A 6: 124,713,142 probably null Het
Pus7l T A 15: 94,540,211 N251I probably damaging Het
Rgs7bp T A 13: 104,964,089 N226I probably damaging Het
Runx2 T A 17: 44,639,685 D327V probably damaging Het
Srp68 A T 11: 116,265,401 C172S probably damaging Het
Stk25 A G 1: 93,623,420 probably null Het
Tbrg4 C T 11: 6,618,468 R437Q probably benign Het
Tedc2 C T 17: 24,217,888 probably null Het
Teddm1a T A 1: 153,892,450 I220N probably damaging Het
Thoc1 G T 18: 9,970,312 E221* probably null Het
Tmem132d G T 5: 127,792,610 D553E possibly damaging Het
Topors A T 4: 40,261,694 V530D probably benign Het
Tpx2 T C 2: 152,889,183 V515A possibly damaging Het
Trim24 A G 6: 37,908,305 H191R probably damaging Het
Ttn G A 2: 76,737,570 R27660W probably damaging Het
Vmn1r203 T C 13: 22,524,358 L103P probably damaging Het
Vmn1r233 C T 17: 20,994,106 S194N probably benign Het
Vmn2r108 T C 17: 20,471,374 K296E probably damaging Het
Vmn2r88 G A 14: 51,413,339 E170K probably benign Het
Zfp740 C T 15: 102,208,749 probably benign Het
Zmym5 A G 14: 56,812,161 probably benign Het
Other mutations in Akap6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Akap6 APN 12 53140980 missense possibly damaging 0.79
IGL00505:Akap6 APN 12 52887102 missense possibly damaging 0.92
IGL01134:Akap6 APN 12 52937217 missense probably damaging 0.96
IGL01458:Akap6 APN 12 52886818 nonsense probably null
IGL01589:Akap6 APN 12 53139664 missense probably damaging 1.00
IGL01592:Akap6 APN 12 53142142 missense probably damaging 1.00
IGL01738:Akap6 APN 12 52886817 missense probably damaging 0.99
IGL01867:Akap6 APN 12 52888008 missense probably damaging 1.00
IGL02025:Akap6 APN 12 53140335 missense probably benign
IGL02041:Akap6 APN 12 53140653 missense probably damaging 1.00
IGL02058:Akap6 APN 12 53140555 missense probably damaging 1.00
IGL02194:Akap6 APN 12 52886823 missense probably benign 0.00
IGL02226:Akap6 APN 12 53010467 splice site probably benign
IGL02323:Akap6 APN 12 53140429 missense probably benign 0.00
IGL02449:Akap6 APN 12 53140188 missense probably damaging 1.00
IGL02475:Akap6 APN 12 53139494 missense probably benign 0.03
IGL02546:Akap6 APN 12 52880738 missense probably damaging 1.00
IGL02547:Akap6 APN 12 53140696 missense probably damaging 1.00
IGL02588:Akap6 APN 12 52886499 nonsense probably null
IGL02608:Akap6 APN 12 53010606 missense probably benign 0.39
IGL02884:Akap6 APN 12 52886622 missense probably benign 0.00
IGL02945:Akap6 APN 12 52880837 missense probably damaging 1.00
IGL03029:Akap6 APN 12 52886412 missense probably damaging 1.00
IGL03129:Akap6 APN 12 53140306 missense probably damaging 1.00
R0133:Akap6 UTSW 12 53139471 nonsense probably null
R0166:Akap6 UTSW 12 53140924 missense probably benign 0.04
R0189:Akap6 UTSW 12 53141254 missense probably benign 0.41
R0532:Akap6 UTSW 12 52887983 missense probably benign 0.00
R0632:Akap6 UTSW 12 52937148 missense probably damaging 1.00
R0666:Akap6 UTSW 12 52911808 missense probably damaging 1.00
R0723:Akap6 UTSW 12 53141902 missense probably damaging 1.00
R0763:Akap6 UTSW 12 53142214 missense possibly damaging 0.93
R0785:Akap6 UTSW 12 52886622 missense probably benign 0.00
R0879:Akap6 UTSW 12 52880799 missense probably damaging 1.00
R0880:Akap6 UTSW 12 53139508 missense possibly damaging 0.93
R1033:Akap6 UTSW 12 53069222 missense probably damaging 0.97
R1055:Akap6 UTSW 12 52880672 nonsense probably null
R1199:Akap6 UTSW 12 52796190 missense probably damaging 1.00
R1295:Akap6 UTSW 12 52887029 missense probably damaging 1.00
R1389:Akap6 UTSW 12 53139520 missense probably benign 0.15
R1471:Akap6 UTSW 12 53141496 missense probably benign 0.05
R1483:Akap6 UTSW 12 52796087 missense probably damaging 1.00
R1512:Akap6 UTSW 12 52937154 missense probably damaging 1.00
R1648:Akap6 UTSW 12 53142006 nonsense probably null
R1791:Akap6 UTSW 12 53069125 missense probably damaging 1.00
R1888:Akap6 UTSW 12 53142175 missense possibly damaging 0.88
R1888:Akap6 UTSW 12 53142175 missense possibly damaging 0.88
R1891:Akap6 UTSW 12 53142175 missense possibly damaging 0.88
R1899:Akap6 UTSW 12 53141852 missense possibly damaging 0.95
R1917:Akap6 UTSW 12 53104612 missense probably benign 0.13
R1970:Akap6 UTSW 12 52938475 missense probably damaging 0.96
R1987:Akap6 UTSW 12 53140795 missense possibly damaging 0.78
R1988:Akap6 UTSW 12 53140795 missense possibly damaging 0.78
R2153:Akap6 UTSW 12 53141404 missense probably benign 0.03
R2567:Akap6 UTSW 12 52938373 missense probably damaging 1.00
R2568:Akap6 UTSW 12 52887278 missense possibly damaging 0.77
R3025:Akap6 UTSW 12 53140143 missense probably benign
R3051:Akap6 UTSW 12 52887033 missense probably damaging 1.00
R3195:Akap6 UTSW 12 53072457 nonsense probably null
R3196:Akap6 UTSW 12 53072457 nonsense probably null
R3426:Akap6 UTSW 12 52888034 missense probably damaging 1.00
R3783:Akap6 UTSW 12 52880769 missense probably damaging 1.00
R3934:Akap6 UTSW 12 53140444 missense possibly damaging 0.92
R3936:Akap6 UTSW 12 53140444 missense possibly damaging 0.92
R3967:Akap6 UTSW 12 53141453 missense probably damaging 1.00
R3970:Akap6 UTSW 12 53141453 missense probably damaging 1.00
R4042:Akap6 UTSW 12 53139379 critical splice acceptor site probably null
R4095:Akap6 UTSW 12 53139462 missense probably damaging 1.00
R4152:Akap6 UTSW 12 53140407 missense probably benign 0.45
R4231:Akap6 UTSW 12 53141038 missense probably damaging 1.00
R4232:Akap6 UTSW 12 53139671 missense probably damaging 1.00
R4233:Akap6 UTSW 12 53139671 missense probably damaging 1.00
R4234:Akap6 UTSW 12 53139671 missense probably damaging 1.00
R4235:Akap6 UTSW 12 53139671 missense probably damaging 1.00
R4236:Akap6 UTSW 12 53139671 missense probably damaging 1.00
R4475:Akap6 UTSW 12 53141643 missense probably benign 0.00
R4513:Akap6 UTSW 12 52796004 missense probably benign 0.03
R4724:Akap6 UTSW 12 52795885 missense possibly damaging 0.80
R4782:Akap6 UTSW 12 52887623 frame shift probably null
R4852:Akap6 UTSW 12 53104675 missense probably damaging 1.00
R5024:Akap6 UTSW 12 53142562 missense probably benign 0.01
R5116:Akap6 UTSW 12 53141515 missense probably benign 0.01
R5164:Akap6 UTSW 12 53142466 missense probably benign
R5225:Akap6 UTSW 12 52886546 missense probably damaging 1.00
R5269:Akap6 UTSW 12 53139843 missense probably damaging 0.99
R5352:Akap6 UTSW 12 52796097 missense probably damaging 1.00
R5496:Akap6 UTSW 12 53140653 missense possibly damaging 0.87
R5551:Akap6 UTSW 12 52795964 missense probably damaging 1.00
R5997:Akap6 UTSW 12 52937233 critical splice donor site probably null
R6137:Akap6 UTSW 12 53140354 missense probably damaging 1.00
R6151:Akap6 UTSW 12 53025792 missense probably damaging 1.00
R6169:Akap6 UTSW 12 53142358 missense probably benign
R6307:Akap6 UTSW 12 53141568 missense possibly damaging 0.85
R6351:Akap6 UTSW 12 53142025 missense probably damaging 0.98
R6479:Akap6 UTSW 12 53141169 missense probably damaging 1.00
R6502:Akap6 UTSW 12 53140215 missense probably damaging 1.00
R6760:Akap6 UTSW 12 53139778 missense probably damaging 1.00
R6778:Akap6 UTSW 12 53025816 missense probably damaging 1.00
R6837:Akap6 UTSW 12 53141262 missense probably damaging 1.00
R6896:Akap6 UTSW 12 52887494 missense probably benign 0.06
R6917:Akap6 UTSW 12 53069168 missense probably null 0.97
R6983:Akap6 UTSW 12 52887653 missense probably damaging 1.00
R7142:Akap6 UTSW 12 52887364 missense probably benign 0.02
R7143:Akap6 UTSW 12 52887364 missense probably benign 0.02
R7216:Akap6 UTSW 12 53140457 missense probably benign 0.02
R7297:Akap6 UTSW 12 52887364 missense probably benign 0.02
R7356:Akap6 UTSW 12 52911864 missense probably damaging 1.00
R7378:Akap6 UTSW 12 53142574 missense probably benign 0.00
R7382:Akap6 UTSW 12 53142171 missense probably benign 0.00
R7498:Akap6 UTSW 12 53142705 nonsense probably null
R7542:Akap6 UTSW 12 53069234 missense probably damaging 1.00
X0062:Akap6 UTSW 12 53142361 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- CATCCCCTTGTAGTCACAGCAG -3'
(R):5'- AGATTCAATGCTCTCCCCGAG -3'

Sequencing Primer
(F):5'- ACAGCAGTGAGTCCTCTCTTGG -3'
(R):5'- TCCCCGAGAGATGAGGCTATGTC -3'
Posted On2015-10-21