Incidental Mutation 'R0276:Usb1'
ID35377
Institutional Source Beutler Lab
Gene Symbol Usb1
Ensembl Gene ENSMUSG00000031792
Gene NameU6 snRNA biogenesis 1
SynonymsAA960436
MMRRC Submission 038498-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R0276 (G1)
Quality Score179
Status Validated
Chromosome8
Chromosomal Location95332284-95347507 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 95333457 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 12 (D12G)
Ref Sequence ENSEMBL: ENSMUSP00000122529 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034245] [ENSMUST00000057717] [ENSMUST00000126180] [ENSMUST00000213059]
Predicted Effect probably damaging
Transcript: ENSMUST00000034245
AA Change: D65G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034245
Gene: ENSMUSG00000031792
AA Change: D65G

DomainStartEndE-ValueType
Pfam:HVSL 45 265 6.3e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000057717
SMART Domains Protein: ENSMUSP00000053397
Gene: ENSMUSG00000046556

DomainStartEndE-ValueType
low complexity region 6 29 N/A INTRINSIC
low complexity region 53 64 N/A INTRINSIC
Blast:ZnF_C2H2 75 99 6e-7 BLAST
ZnF_C2H2 103 123 7.57e1 SMART
ZnF_C2H2 131 153 8.67e-1 SMART
low complexity region 168 189 N/A INTRINSIC
ZnF_C2H2 201 223 9.73e-4 SMART
ZnF_C2H2 229 251 1.47e-3 SMART
ZnF_C2H2 257 279 1.12e-3 SMART
ZnF_C2H2 314 336 6.42e-4 SMART
ZnF_C2H2 342 364 1.2e-3 SMART
ZnF_C2H2 370 392 8.81e-2 SMART
ZnF_C2H2 398 418 2.75e1 SMART
ZnF_C2H2 427 449 1.84e-4 SMART
ZnF_C2H2 457 477 1.27e2 SMART
ZnF_C2H2 485 507 2.79e-4 SMART
ZnF_C2H2 513 535 6.42e-4 SMART
ZnF_C2H2 541 563 4.11e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000126180
AA Change: D12G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000122529
Gene: ENSMUSG00000031792
AA Change: D12G

DomainStartEndE-ValueType
Pfam:HVSL 1 113 6.4e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145060
Predicted Effect probably benign
Transcript: ENSMUST00000213059
Meta Mutation Damage Score 0.306 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.8%
  • 10x: 96.2%
  • 20x: 93.8%
Validation Efficiency 98% (101/103)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with several conserved domains, however, its exact function is not known. Mutations in this gene are associated with poikiloderma with neutropenia (PN), which shows phenotypic overlap with Rothmund-Thomson syndrome (RTS) caused by mutations in the RECQL4 gene. It is believed that this gene product interacts with RECQL4 protein via SMAD4 proteins, explaining the partial clinical overlap between PN and RTS. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Mar 2011]
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts13 A G 2: 26,975,760 N109S possibly damaging Het
Adcy10 T A 1: 165,572,591 M1523K possibly damaging Het
Agtpbp1 C T 13: 59,462,031 S1095N possibly damaging Het
Ang2 C T 14: 51,195,518 V136I probably damaging Het
Arhgap10 A T 8: 77,413,581 M250K probably benign Het
Arhgap33 A T 7: 30,523,244 W1088R probably benign Het
Arhgef15 T C 11: 68,953,472 probably benign Het
Aspm T C 1: 139,478,471 S1699P possibly damaging Het
Atp12a C A 14: 56,387,694 D1014E probably damaging Het
Atp1a4 T A 1: 172,257,901 K45M probably damaging Het
Atp8a1 A T 5: 67,786,673 probably benign Het
Baiap3 A C 17: 25,243,687 F1099C probably damaging Het
Bcas3 T A 11: 85,470,837 probably null Het
Bms1 G A 6: 118,408,134 T371M possibly damaging Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Capn3 T C 2: 120,488,065 probably benign Het
Ccdc180 A G 4: 45,923,534 D1105G probably damaging Het
Ccdc33 G T 9: 58,058,392 P364Q probably damaging Het
Ccdc36 A T 9: 108,428,440 M11K possibly damaging Het
Clstn3 A G 6: 124,431,740 probably benign Het
Cntrl A T 2: 35,151,732 Y619F possibly damaging Het
Col12a1 A T 9: 79,630,741 Y2514* probably null Het
Cpt1b T C 15: 89,419,959 H503R probably benign Het
Crb1 T A 1: 139,323,335 T293S possibly damaging Het
D130043K22Rik C T 13: 24,858,045 T319I possibly damaging Het
Dzip1l G A 9: 99,660,998 R502Q probably benign Het
Efcab5 A G 11: 77,129,876 M673T probably damaging Het
Efcab5 G A 11: 77,140,923 R42W probably damaging Het
F2rl3 A G 8: 72,762,798 T218A probably benign Het
Fam135a C T 1: 24,067,964 R31H probably damaging Het
Fam84b G T 15: 60,823,674 Y74* probably null Het
Fcer2a A T 8: 3,689,811 N53K possibly damaging Het
Gm14085 T A 2: 122,521,928 S389T probably damaging Het
Golgb1 A C 16: 36,913,876 K1162Q probably damaging Het
Gpr137b A T 13: 13,367,575 probably benign Het
Haspin A T 11: 73,136,487 L592Q probably damaging Het
Helq A G 5: 100,790,147 F478L probably damaging Het
Il17rb T A 14: 30,004,380 T84S probably damaging Het
Itga4 T C 2: 79,321,493 L880P probably damaging Het
Itih5 A G 2: 10,185,564 I61V possibly damaging Het
Ivl G A 3: 92,571,514 L415F unknown Het
Kif2a A G 13: 106,976,650 probably benign Het
Kmt2d T C 15: 98,850,311 probably benign Het
Lars2 A G 9: 123,438,121 probably benign Het
Lilrb4a T C 10: 51,491,581 V73A probably benign Het
Lrrc8a A G 2: 30,256,788 D538G possibly damaging Het
Lrrk1 G A 7: 66,296,263 probably benign Het
Mc2r A T 18: 68,408,132 I30K possibly damaging Het
Mybbp1a C A 11: 72,450,107 probably null Het
Napg C T 18: 62,986,963 R149C probably damaging Het
Ncam2 A G 16: 81,517,629 probably benign Het
Nlk T C 11: 78,571,475 I509V probably benign Het
Nlrp2 A T 7: 5,328,109 N429K probably benign Het
Nlrp9b A G 7: 20,028,498 T247A probably benign Het
Noxo1 A T 17: 24,700,162 probably null Het
Olfr1212 T A 2: 88,958,755 C96* probably null Het
Olfr139 A G 11: 74,045,118 I52T probably damaging Het
Olfr353 A T 2: 36,890,023 M275K probably benign Het
Olfr701 A T 7: 106,818,697 I205L probably benign Het
Olfr734 C A 14: 50,320,179 A219S probably benign Het
Oxr1 T C 15: 41,820,062 S294P probably damaging Het
Pfpl A G 19: 12,429,237 Y284C probably damaging Het
Pi16 A T 17: 29,326,943 T232S probably benign Het
Plcxd2 A T 16: 46,009,707 N50K probably benign Het
Plekhn1 T A 4: 156,228,246 N52Y probably damaging Het
Prl2c5 T C 13: 13,183,049 probably benign Het
Prrc2b G A 2: 32,219,654 V1080I probably damaging Het
Psg28 A T 7: 18,430,396 N130K probably benign Het
Psme4 C A 11: 30,811,980 T440K probably damaging Het
Ptcd2 T C 13: 99,321,596 K296E probably benign Het
Ptprq T C 10: 107,542,735 probably null Het
Rab5b A C 10: 128,686,746 probably null Het
Rft1 T A 14: 30,690,583 S534T probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rsu1 A T 2: 13,170,135 probably benign Het
Senp6 A G 9: 80,136,747 M887V probably benign Het
Sgcz T A 8: 37,952,919 M60L probably benign Het
Siglec1 G A 2: 131,083,941 Q282* probably null Het
Sipa1l2 T C 8: 125,421,940 T1655A probably damaging Het
Slc43a3 G A 2: 84,937,663 probably benign Het
Snx29 T C 16: 11,738,373 V756A probably benign Het
Spta1 T A 1: 174,217,894 H1539Q probably damaging Het
Stk3 A C 15: 35,099,469 S104A probably damaging Het
Stk38 C A 17: 28,992,416 probably null Het
Stx6 T C 1: 155,174,163 probably benign Het
Thbs4 G A 13: 92,775,532 T230I probably benign Het
Thrsp A G 7: 97,417,502 M1T probably null Het
Tmem63b A T 17: 45,675,373 probably benign Het
Top2a A G 11: 99,009,907 probably benign Het
Tpd52l2 T C 2: 181,502,059 probably null Het
Trak1 A G 9: 121,454,338 E390G probably damaging Het
Trappc3 T A 4: 126,273,952 D101E possibly damaging Het
Trhr A G 15: 44,197,086 M1V probably null Het
Triobp T A 15: 78,973,676 I1159K probably benign Het
Unc45a A G 7: 80,326,297 probably benign Het
Ushbp1 C T 8: 71,394,649 C113Y possibly damaging Het
Vim A G 2: 13,574,859 K143R probably benign Het
Vmn2r75 T C 7: 86,148,307 K766R probably benign Het
Wdr92 T C 11: 17,229,821 I274T probably benign Het
Xpo5 T G 17: 46,241,507 C1089G probably damaging Het
Other mutations in Usb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03164:Usb1 APN 8 95333484 missense probably damaging 1.00
R0385:Usb1 UTSW 8 95345318 missense probably damaging 1.00
R0730:Usb1 UTSW 8 95344041 missense probably damaging 1.00
R0801:Usb1 UTSW 8 95333540 splice site probably null
R1497:Usb1 UTSW 8 95338697 missense probably benign 0.00
R2230:Usb1 UTSW 8 95344046 missense probably damaging 1.00
R2231:Usb1 UTSW 8 95344046 missense probably damaging 1.00
R2232:Usb1 UTSW 8 95344046 missense probably damaging 1.00
R2402:Usb1 UTSW 8 95343131 missense probably benign 0.06
R2507:Usb1 UTSW 8 95343124 missense probably damaging 1.00
R3821:Usb1 UTSW 8 95333433 missense probably benign 0.35
R5085:Usb1 UTSW 8 95344051 missense probably damaging 0.98
R5834:Usb1 UTSW 8 95333533 utr 3 prime probably benign
Predicted Primers PCR Primer
(F):5'- AGTTCGAGGCCAACATGGCAAG -3'
(R):5'- AACACCCAGTGCAGGAAGGTCTAC -3'

Sequencing Primer
(F):5'- gccaacatggcaagacTGG -3'
(R):5'- ACTTCAGCAGTTAGGCAGTC -3'
Posted On2013-05-09