Incidental Mutation 'R4716:Lactb2'
ID353997
Institutional Source Beutler Lab
Gene Symbol Lactb2
Ensembl Gene ENSMUSG00000025937
Gene Namelactamase, beta 2
SynonymsE430032H21Rik, Cgi-83
MMRRC Submission 041983-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R4716 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location13623330-13660546 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 13638395 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 143 (P143L)
Ref Sequence ENSEMBL: ENSMUSP00000027071 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027071]
Predicted Effect probably damaging
Transcript: ENSMUST00000027071
AA Change: P143L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027071
Gene: ENSMUSG00000025937
AA Change: P143L

DomainStartEndE-ValueType
Lactamase_B 30 199 6.69e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156222
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194537
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Male mice homozygous for a null allele exhibit at 40 days of age preceeded by decreased body size, lethargy, enlarged and pale liver and hepatic steatosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik A G 19: 45,960,342 S233P probably damaging Het
Abi3bp C T 16: 56,650,725 R578* probably null Het
Adam8 T A 7: 139,983,938 D717V probably benign Het
Aknad1 T C 3: 108,775,101 probably null Het
Alk A T 17: 72,205,942 W341R probably damaging Het
Ankdd1b G A 13: 96,454,583 Q101* probably null Het
Anpep A C 7: 79,826,632 S829A probably benign Het
Ate1 A T 7: 130,513,781 C72S probably damaging Het
Atp6v0a4 G A 6: 38,061,064 L533F probably damaging Het
Bach1 T C 16: 87,715,379 probably benign Het
Baz2b T C 2: 59,969,255 D240G probably benign Het
Cdc14b C T 13: 64,209,200 S21N probably damaging Het
Cdh3 A G 8: 106,543,888 I466V probably benign Het
Cog1 A G 11: 113,657,097 E137G probably damaging Het
Col4a2 A G 8: 11,402,224 D180G probably damaging Het
Cyp2c40 A T 19: 39,802,661 probably null Het
Dclk2 C T 3: 86,919,881 R97H probably damaging Het
Ddx52 T C 11: 83,955,205 probably null Het
Dhx58 C T 11: 100,696,971 probably null Het
Dmp1 T A 5: 104,212,561 S368T probably damaging Het
Dnah17 C A 11: 118,073,648 V2435L probably benign Het
Dnajc7 A G 11: 100,619,576 V10A probably benign Het
Dscam G T 16: 96,619,571 T1705K possibly damaging Het
Dscaml1 G A 9: 45,450,592 V217M probably damaging Het
Dync2h1 A G 9: 7,142,648 probably null Het
F5 A G 1: 164,193,919 D1321G probably damaging Het
Fam174a C T 1: 95,314,045 P77S probably benign Het
Fars2 G A 13: 36,205,068 R180H probably damaging Het
Fnbp1 T C 2: 31,055,520 T154A probably benign Het
Fsip2 T A 2: 82,974,859 N507K probably damaging Het
Glg1 G T 8: 111,160,775 Y449* probably null Het
Gm15130 A T 2: 111,134,215 Y187* probably null Het
Gm973 A T 1: 59,552,554 K366* probably null Het
Hao1 A G 2: 134,505,620 I255T probably damaging Het
Herc6 T A 6: 57,598,438 V148E probably damaging Het
Hist1h2bj T A 13: 22,043,363 V45E possibly damaging Het
Insm2 T A 12: 55,600,892 C474S possibly damaging Het
Itch T C 2: 155,210,582 probably null Het
Itga2 A G 13: 114,857,373 V748A probably damaging Het
Itga9 T A 9: 118,681,758 S452T probably damaging Het
Kdm4b C A 17: 56,386,178 D338E probably benign Het
Krt40 G A 11: 99,540,219 R155C probably damaging Het
Krtap16-1 A G 11: 99,985,174 V468A probably damaging Het
Lrba C A 3: 86,642,714 T2330K probably damaging Het
Lrp2bp A T 8: 46,013,171 I106F probably benign Het
Luzp2 A G 7: 54,835,962 K2E probably damaging Het
Lypd6 T C 2: 50,188,843 probably null Het
Maml1 A T 11: 50,257,867 D1015E probably benign Het
Mdfi T G 17: 47,820,981 D106A possibly damaging Het
Olfm3 T C 3: 115,081,106 M17T probably benign Het
Olfr136 A C 17: 38,335,840 I228L possibly damaging Het
Olfr1394 A G 11: 49,160,890 Y292C probably damaging Het
Olfr894 T A 9: 38,219,418 N198K probably damaging Het
Olfr948 A G 9: 39,319,429 F62L probably benign Het
Otud7b T G 3: 96,150,910 L261V probably damaging Het
P2ry1 A G 3: 61,003,472 N11D probably damaging Het
Pate2 T C 9: 35,685,682 probably benign Het
Pcdhb16 A T 18: 37,479,405 T473S probably benign Het
Per1 A G 11: 69,101,231 E137G probably damaging Het
Phf11d T C 14: 59,353,342 T189A probably benign Het
Pik3r5 C A 11: 68,495,204 S738R possibly damaging Het
Pikfyve A G 1: 65,246,476 Y913C possibly damaging Het
Pkd1 T G 17: 24,576,133 S2265A probably damaging Het
Pkhd1l1 C A 15: 44,556,032 N2964K probably damaging Het
Plch1 T G 3: 63,781,546 D79A probably damaging Het
Pnliprp1 A C 19: 58,740,469 T363P possibly damaging Het
Ppp1r10 T A 17: 35,929,460 D547E probably benign Het
Prkdc T A 16: 15,810,837 I3482K probably benign Het
Ptpn4 A G 1: 119,721,868 Y333H probably damaging Het
Ptpru T A 4: 131,820,968 M73L probably benign Het
Rrp12 A G 19: 41,877,428 Y698H probably damaging Het
Scaf8 T C 17: 3,177,123 F338L unknown Het
Slc17a1 G T 13: 23,880,593 V347L probably benign Het
Slc1a2 T A 2: 102,748,538 V263E probably damaging Het
Slc29a4 T C 5: 142,718,572 V327A probably benign Het
Slc6a3 A C 13: 73,557,076 I229L probably benign Het
Sos2 T C 12: 69,607,371 I703V probably benign Het
Srpk1 T C 17: 28,622,008 T15A probably benign Het
St6gal2 A T 17: 55,510,366 Q510L probably benign Het
Stk24 T C 14: 121,294,718 D289G possibly damaging Het
Taf2 T G 15: 55,065,968 K64T probably benign Het
Tbx3 A G 5: 119,675,670 E257G possibly damaging Het
Tmem102 A T 11: 69,804,196 F317I probably damaging Het
Trav10 A G 14: 53,506,040 S33G possibly damaging Het
Ttn T A 2: 76,915,064 I5214F probably damaging Het
Ube2f T A 1: 91,254,280 L2Q probably damaging Het
Ube4b A G 4: 149,344,612 F857L probably damaging Het
Vmn2r18 T A 5: 151,562,137 I631F possibly damaging Het
Zfp280d T A 9: 72,312,665 S241T possibly damaging Het
Zfp638 T A 6: 83,979,562 L1717* probably null Het
Zfp719 A G 7: 43,591,111 N708D possibly damaging Het
Other mutations in Lactb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Lactb2 APN 1 13660374 missense probably damaging 1.00
IGL00595:Lactb2 APN 1 13630126 missense probably benign 0.05
IGL00730:Lactb2 APN 1 13647516 splice site probably benign
R0371:Lactb2 UTSW 1 13650760 missense possibly damaging 0.69
R0782:Lactb2 UTSW 1 13647451 missense probably benign 0.18
R1670:Lactb2 UTSW 1 13660417 missense probably damaging 0.99
R2324:Lactb2 UTSW 1 13638296 missense probably damaging 1.00
R2418:Lactb2 UTSW 1 13660339 missense possibly damaging 0.93
R3500:Lactb2 UTSW 1 13660449 start codon destroyed probably null 1.00
R4345:Lactb2 UTSW 1 13660350 missense probably damaging 1.00
R4664:Lactb2 UTSW 1 13647400 missense probably damaging 1.00
R4665:Lactb2 UTSW 1 13647400 missense probably damaging 1.00
R5363:Lactb2 UTSW 1 13630132 missense probably benign 0.22
R5658:Lactb2 UTSW 1 13627418 missense probably benign 0.03
R5734:Lactb2 UTSW 1 13660387 missense probably damaging 1.00
R5918:Lactb2 UTSW 1 13650730 missense probably benign 0.32
R6419:Lactb2 UTSW 1 13638235 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCAAATGGACATTCCTTAGCATG -3'
(R):5'- TTTTACAAGCAACCCCTGGG -3'

Sequencing Primer
(F):5'- GGACATTCCTTAGCATGGTAAAAG -3'
(R):5'- CGTCTTGTCTACAGGTGA -3'
Posted On2015-10-21