Incidental Mutation 'R4716:Pikfyve'
ID 354001
Institutional Source Beutler Lab
Gene Symbol Pikfyve
Ensembl Gene ENSMUSG00000025949
Gene Name phosphoinositide kinase, FYVE type zinc finger containing
Synonyms PipkIII, Pip5k3, 5230400C17Rik
MMRRC Submission 041983-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4716 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 65225842-65317854 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 65285635 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 913 (Y913C)
Ref Sequence ENSEMBL: ENSMUSP00000079926 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081154] [ENSMUST00000097707] [ENSMUST00000190058]
AlphaFold Q9Z1T6
Predicted Effect possibly damaging
Transcript: ENSMUST00000081154
AA Change: Y913C

PolyPhen 2 Score 0.841 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000079926
Gene: ENSMUSG00000025949
AA Change: Y913C

DomainStartEndE-ValueType
low complexity region 58 81 N/A INTRINSIC
FYVE 161 230 5.95e-18 SMART
DEP 376 451 9.05e-27 SMART
Pfam:Cpn60_TCP1 547 822 2e-37 PFAM
low complexity region 1177 1189 N/A INTRINSIC
low complexity region 1516 1536 N/A INTRINSIC
PIPKc 1745 2039 3.03e-162 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000097707
AA Change: Y958C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000095314
Gene: ENSMUSG00000025949
AA Change: Y958C

DomainStartEndE-ValueType
low complexity region 58 81 N/A INTRINSIC
FYVE 150 219 5.95e-18 SMART
DEP 365 440 9.05e-27 SMART
Pfam:Cpn60_TCP1 590 864 1.8e-35 PFAM
low complexity region 1222 1234 N/A INTRINSIC
low complexity region 1561 1581 N/A INTRINSIC
PIPKc 1790 2084 3.03e-162 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190058
SMART Domains Protein: ENSMUSP00000140204
Gene: ENSMUSG00000025949

DomainStartEndE-ValueType
low complexity region 58 81 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphorylated derivatives of phosphatidylinositol (PtdIns) regulate cytoskeletal functions, membrane trafficking, and receptor signaling by recruiting protein complexes to cell- and endosomal-membranes. Humans have multiple PtdIns proteins that differ by the degree and position of phosphorylation of the inositol ring. This gene encodes an enzyme (PIKfyve; also known as phosphatidylinositol-3-phosphate 5-kinase type III or PIPKIII) that phosphorylates the D-5 position in PtdIns and phosphatidylinositol-3-phosphate (PtdIns3P) to make PtdIns5P and PtdIns(3,5)biphosphate. The D-5 position also can be phosphorylated by type I PtdIns4P-5-kinases (PIP5Ks) that are encoded by distinct genes and preferentially phosphorylate D-4 phosphorylated PtdIns. In contrast, PIKfyve preferentially phosphorylates D-3 phosphorylated PtdIns. In addition to being a lipid kinase, PIKfyve also has protein kinase activity. PIKfyve regulates endomembrane homeostasis and plays a role in the biogenesis of endosome carrier vesicles from early endosomes. Mutations in this gene cause corneal fleck dystrophy (CFD); an autosomal dominant disorder characterized by numerous small white flecks present in all layers of the corneal stroma. Histologically, these flecks appear to be keratocytes distended with lipid and mucopolysaccharide filled intracytoplasmic vacuoles. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null allele die prior to implantation with reduced numbers of inner cell mass and trophectoderm cells and blastocoele abnormalities. Mice homozygous for a second null allele show embryonic lethality between somite formation and embryo turning with abnormal visceral endoderm. [provided by MGI curators]
Allele List at MGI

All alleles(16) : Gene trapped(16)

Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp C T 16: 56,471,088 (GRCm39) R578* probably null Het
Adam8 T A 7: 139,563,851 (GRCm39) D717V probably benign Het
Aknad1 T C 3: 108,682,417 (GRCm39) probably null Het
Alk A T 17: 72,512,937 (GRCm39) W341R probably damaging Het
Ankdd1b G A 13: 96,591,091 (GRCm39) Q101* probably null Het
Anpep A C 7: 79,476,380 (GRCm39) S829A probably benign Het
Armh3 A G 19: 45,948,781 (GRCm39) S233P probably damaging Het
Ate1 A T 7: 130,115,511 (GRCm39) C72S probably damaging Het
Atp6v0a4 G A 6: 38,037,999 (GRCm39) L533F probably damaging Het
Bach1 T C 16: 87,512,267 (GRCm39) probably benign Het
Baz2b T C 2: 59,799,599 (GRCm39) D240G probably benign Het
Cdc14b C T 13: 64,357,014 (GRCm39) S21N probably damaging Het
Cdh3 A G 8: 107,270,520 (GRCm39) I466V probably benign Het
Cog1 A G 11: 113,547,923 (GRCm39) E137G probably damaging Het
Col4a2 A G 8: 11,452,224 (GRCm39) D180G probably damaging Het
Cyp2c40 A T 19: 39,791,105 (GRCm39) probably null Het
Dclk2 C T 3: 86,827,188 (GRCm39) R97H probably damaging Het
Ddx52 T C 11: 83,846,031 (GRCm39) probably null Het
Dhx58 C T 11: 100,587,797 (GRCm39) probably null Het
Dmp1 T A 5: 104,360,427 (GRCm39) S368T probably damaging Het
Dnah17 C A 11: 117,964,474 (GRCm39) V2435L probably benign Het
Dnajc7 A G 11: 100,510,402 (GRCm39) V10A probably benign Het
Dscam G T 16: 96,420,771 (GRCm39) T1705K possibly damaging Het
Dscaml1 G A 9: 45,361,890 (GRCm39) V217M probably damaging Het
Dync2h1 A G 9: 7,142,648 (GRCm39) probably null Het
F5 A G 1: 164,021,488 (GRCm39) D1321G probably damaging Het
Fam174a C T 1: 95,241,770 (GRCm39) P77S probably benign Het
Fars2 G A 13: 36,389,051 (GRCm39) R180H probably damaging Het
Fnbp1 T C 2: 30,945,532 (GRCm39) T154A probably benign Het
Fsip2 T A 2: 82,805,203 (GRCm39) N507K probably damaging Het
Glg1 G T 8: 111,887,407 (GRCm39) Y449* probably null Het
Gm15130 A T 2: 110,964,560 (GRCm39) Y187* probably null Het
Gm973 A T 1: 59,591,713 (GRCm39) K366* probably null Het
H2bc11 T A 13: 22,227,533 (GRCm39) V45E possibly damaging Het
Hao1 A G 2: 134,347,540 (GRCm39) I255T probably damaging Het
Herc6 T A 6: 57,575,423 (GRCm39) V148E probably damaging Het
Insm2 T A 12: 55,647,677 (GRCm39) C474S possibly damaging Het
Itch T C 2: 155,052,502 (GRCm39) probably null Het
Itga2 A G 13: 114,993,909 (GRCm39) V748A probably damaging Het
Itga9 T A 9: 118,510,826 (GRCm39) S452T probably damaging Het
Kdm4b C A 17: 56,693,178 (GRCm39) D338E probably benign Het
Krt40 G A 11: 99,431,045 (GRCm39) R155C probably damaging Het
Krtap16-1 A G 11: 99,876,000 (GRCm39) V468A probably damaging Het
Lactb2 G A 1: 13,708,619 (GRCm39) P143L probably damaging Het
Lrba C A 3: 86,550,021 (GRCm39) T2330K probably damaging Het
Lrp2bp A T 8: 46,466,208 (GRCm39) I106F probably benign Het
Luzp2 A G 7: 54,485,710 (GRCm39) K2E probably damaging Het
Lypd6 T C 2: 50,078,855 (GRCm39) probably null Het
Maml1 A T 11: 50,148,694 (GRCm39) D1015E probably benign Het
Mdfi T G 17: 48,131,906 (GRCm39) D106A possibly damaging Het
Olfm3 T C 3: 114,874,755 (GRCm39) M17T probably benign Het
Or2n1d A C 17: 38,646,731 (GRCm39) I228L possibly damaging Het
Or2o1 A G 11: 49,051,717 (GRCm39) Y292C probably damaging Het
Or8c16 T A 9: 38,130,714 (GRCm39) N198K probably damaging Het
Or8g30 A G 9: 39,230,725 (GRCm39) F62L probably benign Het
Otud7b T G 3: 96,058,227 (GRCm39) L261V probably damaging Het
P2ry1 A G 3: 60,910,893 (GRCm39) N11D probably damaging Het
Pate2 T C 9: 35,596,978 (GRCm39) probably benign Het
Pcdhb16 A T 18: 37,612,458 (GRCm39) T473S probably benign Het
Per1 A G 11: 68,992,057 (GRCm39) E137G probably damaging Het
Phf11d T C 14: 59,590,791 (GRCm39) T189A probably benign Het
Pik3r5 C A 11: 68,386,030 (GRCm39) S738R possibly damaging Het
Pkd1 T G 17: 24,795,107 (GRCm39) S2265A probably damaging Het
Pkhd1l1 C A 15: 44,419,428 (GRCm39) N2964K probably damaging Het
Plch1 T G 3: 63,688,967 (GRCm39) D79A probably damaging Het
Pnliprp1 A C 19: 58,728,901 (GRCm39) T363P possibly damaging Het
Ppp1r10 T A 17: 36,240,352 (GRCm39) D547E probably benign Het
Prkdc T A 16: 15,628,701 (GRCm39) I3482K probably benign Het
Ptpn4 A G 1: 119,649,598 (GRCm39) Y333H probably damaging Het
Ptpru T A 4: 131,548,279 (GRCm39) M73L probably benign Het
Rrp12 A G 19: 41,865,867 (GRCm39) Y698H probably damaging Het
Scaf8 T C 17: 3,227,398 (GRCm39) F338L unknown Het
Slc17a1 G T 13: 24,064,576 (GRCm39) V347L probably benign Het
Slc1a2 T A 2: 102,578,883 (GRCm39) V263E probably damaging Het
Slc29a4 T C 5: 142,704,327 (GRCm39) V327A probably benign Het
Slc6a3 A C 13: 73,705,195 (GRCm39) I229L probably benign Het
Sos2 T C 12: 69,654,145 (GRCm39) I703V probably benign Het
Srpk1 T C 17: 28,840,982 (GRCm39) T15A probably benign Het
St6gal2 A T 17: 55,817,367 (GRCm39) Q510L probably benign Het
Stk24 T C 14: 121,532,130 (GRCm39) D289G possibly damaging Het
Taf2 T G 15: 54,929,364 (GRCm39) K64T probably benign Het
Tbx3 A G 5: 119,813,735 (GRCm39) E257G possibly damaging Het
Tmem102 A T 11: 69,695,022 (GRCm39) F317I probably damaging Het
Trav10 A G 14: 53,743,497 (GRCm39) S33G possibly damaging Het
Ttn T A 2: 76,745,408 (GRCm39) I5214F probably damaging Het
Ube2f T A 1: 91,182,002 (GRCm39) L2Q probably damaging Het
Ube4b A G 4: 149,429,069 (GRCm39) F857L probably damaging Het
Vmn2r18 T A 5: 151,485,602 (GRCm39) I631F possibly damaging Het
Zfp280d T A 9: 72,219,947 (GRCm39) S241T possibly damaging Het
Zfp638 T A 6: 83,956,544 (GRCm39) L1717* probably null Het
Zfp719 A G 7: 43,240,535 (GRCm39) N708D possibly damaging Het
Other mutations in Pikfyve
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Pikfyve APN 1 65,299,280 (GRCm39) critical splice donor site probably null
IGL01135:Pikfyve APN 1 65,290,794 (GRCm39) missense probably damaging 0.96
IGL01511:Pikfyve APN 1 65,298,028 (GRCm39) nonsense probably null
IGL01759:Pikfyve APN 1 65,292,512 (GRCm39) missense probably benign 0.06
IGL01888:Pikfyve APN 1 65,262,799 (GRCm39) missense probably damaging 1.00
IGL01967:Pikfyve APN 1 65,303,524 (GRCm39) missense possibly damaging 0.89
IGL02055:Pikfyve APN 1 65,277,703 (GRCm39) critical splice donor site probably null
IGL02119:Pikfyve APN 1 65,311,730 (GRCm39) missense probably damaging 1.00
IGL02141:Pikfyve APN 1 65,285,556 (GRCm39) missense probably benign 0.13
IGL02207:Pikfyve APN 1 65,290,837 (GRCm39) critical splice donor site probably null
IGL02380:Pikfyve APN 1 65,295,180 (GRCm39) missense probably damaging 0.99
IGL02400:Pikfyve APN 1 65,291,728 (GRCm39) missense probably damaging 1.00
IGL02403:Pikfyve APN 1 65,283,663 (GRCm39) missense probably damaging 0.99
IGL02426:Pikfyve APN 1 65,290,771 (GRCm39) missense possibly damaging 0.77
IGL02496:Pikfyve APN 1 65,303,535 (GRCm39) missense possibly damaging 0.94
IGL02573:Pikfyve APN 1 65,270,014 (GRCm39) critical splice donor site probably null
IGL02746:Pikfyve APN 1 65,273,431 (GRCm39) missense probably damaging 1.00
IGL02814:Pikfyve APN 1 65,289,353 (GRCm39) nonsense probably null
IGL02890:Pikfyve APN 1 65,269,956 (GRCm39) missense probably benign 0.00
IGL03102:Pikfyve APN 1 65,291,626 (GRCm39) nonsense probably null
IGL03294:Pikfyve APN 1 65,286,226 (GRCm39) missense probably damaging 1.00
falcon UTSW 1 65,235,900 (GRCm39) missense probably damaging 1.00
oompa UTSW 1 65,235,865 (GRCm39) missense probably damaging 1.00
wonka UTSW 1 65,235,865 (GRCm39) missense probably damaging 1.00
G5538:Pikfyve UTSW 1 65,242,075 (GRCm39) missense probably damaging 1.00
R0031:Pikfyve UTSW 1 65,255,088 (GRCm39) splice site probably benign
R0196:Pikfyve UTSW 1 65,295,231 (GRCm39) missense possibly damaging 0.92
R0212:Pikfyve UTSW 1 65,302,064 (GRCm39) missense probably benign 0.41
R0319:Pikfyve UTSW 1 65,285,490 (GRCm39) missense probably benign 0.01
R0332:Pikfyve UTSW 1 65,303,558 (GRCm39) missense probably benign 0.02
R0389:Pikfyve UTSW 1 65,235,865 (GRCm39) missense probably damaging 1.00
R0443:Pikfyve UTSW 1 65,235,865 (GRCm39) missense probably damaging 1.00
R0503:Pikfyve UTSW 1 65,259,058 (GRCm39) missense probably damaging 0.97
R0722:Pikfyve UTSW 1 65,292,682 (GRCm39) missense probably damaging 0.99
R0906:Pikfyve UTSW 1 65,292,556 (GRCm39) missense probably damaging 1.00
R0907:Pikfyve UTSW 1 65,241,989 (GRCm39) missense possibly damaging 0.64
R0970:Pikfyve UTSW 1 65,304,983 (GRCm39) missense probably damaging 0.99
R1188:Pikfyve UTSW 1 65,286,118 (GRCm39) missense possibly damaging 0.46
R1412:Pikfyve UTSW 1 65,241,989 (GRCm39) missense possibly damaging 0.64
R1421:Pikfyve UTSW 1 65,310,470 (GRCm39) missense probably damaging 1.00
R1468:Pikfyve UTSW 1 65,290,825 (GRCm39) missense probably damaging 0.98
R1468:Pikfyve UTSW 1 65,290,825 (GRCm39) missense probably damaging 0.98
R1472:Pikfyve UTSW 1 65,263,360 (GRCm39) missense probably damaging 0.96
R1478:Pikfyve UTSW 1 65,302,136 (GRCm39) critical splice donor site probably null
R1501:Pikfyve UTSW 1 65,304,443 (GRCm39) missense possibly damaging 0.84
R1757:Pikfyve UTSW 1 65,291,707 (GRCm39) missense probably damaging 0.99
R1773:Pikfyve UTSW 1 65,285,529 (GRCm39) missense probably benign
R1773:Pikfyve UTSW 1 65,231,430 (GRCm39) missense probably damaging 0.99
R1795:Pikfyve UTSW 1 65,291,716 (GRCm39) missense probably damaging 1.00
R1855:Pikfyve UTSW 1 65,297,957 (GRCm39) missense probably benign 0.03
R1905:Pikfyve UTSW 1 65,231,454 (GRCm39) critical splice donor site probably null
R1995:Pikfyve UTSW 1 65,285,867 (GRCm39) missense probably damaging 1.00
R2034:Pikfyve UTSW 1 65,261,516 (GRCm39) missense probably damaging 1.00
R2045:Pikfyve UTSW 1 65,292,512 (GRCm39) missense probably benign 0.06
R2229:Pikfyve UTSW 1 65,307,014 (GRCm39) missense probably damaging 1.00
R2295:Pikfyve UTSW 1 65,285,835 (GRCm39) missense probably damaging 0.99
R2913:Pikfyve UTSW 1 65,292,676 (GRCm39) missense probably damaging 1.00
R3818:Pikfyve UTSW 1 65,284,917 (GRCm39) missense probably damaging 1.00
R3832:Pikfyve UTSW 1 65,283,579 (GRCm39) missense probably damaging 0.99
R3850:Pikfyve UTSW 1 65,270,004 (GRCm39) missense probably damaging 1.00
R3946:Pikfyve UTSW 1 65,235,840 (GRCm39) missense probably damaging 1.00
R4105:Pikfyve UTSW 1 65,229,679 (GRCm39) unclassified probably benign
R4542:Pikfyve UTSW 1 65,283,589 (GRCm39) missense probably damaging 1.00
R4574:Pikfyve UTSW 1 65,231,351 (GRCm39) missense probably damaging 1.00
R4601:Pikfyve UTSW 1 65,273,421 (GRCm39) missense probably damaging 1.00
R4667:Pikfyve UTSW 1 65,289,432 (GRCm39) missense probably damaging 1.00
R4668:Pikfyve UTSW 1 65,289,432 (GRCm39) missense probably damaging 1.00
R4669:Pikfyve UTSW 1 65,289,432 (GRCm39) missense probably damaging 1.00
R4707:Pikfyve UTSW 1 65,307,005 (GRCm39) missense probably benign
R4758:Pikfyve UTSW 1 65,311,674 (GRCm39) missense possibly damaging 0.84
R4784:Pikfyve UTSW 1 65,307,005 (GRCm39) missense probably benign
R4785:Pikfyve UTSW 1 65,307,005 (GRCm39) missense probably benign
R4805:Pikfyve UTSW 1 65,307,959 (GRCm39) missense probably damaging 0.99
R4831:Pikfyve UTSW 1 65,235,900 (GRCm39) missense probably damaging 1.00
R4837:Pikfyve UTSW 1 65,285,749 (GRCm39) missense possibly damaging 0.92
R5064:Pikfyve UTSW 1 65,292,566 (GRCm39) missense probably damaging 1.00
R5115:Pikfyve UTSW 1 65,263,276 (GRCm39) intron probably benign
R5265:Pikfyve UTSW 1 65,306,988 (GRCm39) missense possibly damaging 0.72
R5279:Pikfyve UTSW 1 65,235,858 (GRCm39) nonsense probably null
R5384:Pikfyve UTSW 1 65,283,568 (GRCm39) missense probably damaging 1.00
R5387:Pikfyve UTSW 1 65,304,427 (GRCm39) missense possibly damaging 0.94
R5461:Pikfyve UTSW 1 65,274,192 (GRCm39) missense probably damaging 1.00
R5467:Pikfyve UTSW 1 65,291,654 (GRCm39) missense probably damaging 1.00
R5560:Pikfyve UTSW 1 65,292,566 (GRCm39) missense probably damaging 1.00
R5575:Pikfyve UTSW 1 65,312,889 (GRCm39) missense probably damaging 1.00
R5611:Pikfyve UTSW 1 65,295,247 (GRCm39) missense probably damaging 0.96
R5663:Pikfyve UTSW 1 65,255,187 (GRCm39) missense probably benign 0.09
R5891:Pikfyve UTSW 1 65,241,896 (GRCm39) missense probably damaging 1.00
R5960:Pikfyve UTSW 1 65,292,597 (GRCm39) nonsense probably null
R6026:Pikfyve UTSW 1 65,311,856 (GRCm39) missense probably damaging 1.00
R6057:Pikfyve UTSW 1 65,311,730 (GRCm39) missense probably damaging 1.00
R6101:Pikfyve UTSW 1 65,303,504 (GRCm39) critical splice acceptor site probably null
R6105:Pikfyve UTSW 1 65,303,504 (GRCm39) critical splice acceptor site probably null
R6161:Pikfyve UTSW 1 65,255,202 (GRCm39) missense probably benign 0.36
R6287:Pikfyve UTSW 1 65,292,691 (GRCm39) critical splice donor site probably null
R6290:Pikfyve UTSW 1 65,242,084 (GRCm39) critical splice donor site probably null
R6296:Pikfyve UTSW 1 65,302,112 (GRCm39) missense probably damaging 0.99
R6516:Pikfyve UTSW 1 65,304,940 (GRCm39) missense probably benign 0.35
R6835:Pikfyve UTSW 1 65,298,002 (GRCm39) missense probably damaging 0.98
R6994:Pikfyve UTSW 1 65,291,689 (GRCm39) missense probably damaging 1.00
R6997:Pikfyve UTSW 1 65,285,822 (GRCm39) missense probably damaging 1.00
R7038:Pikfyve UTSW 1 65,273,520 (GRCm39) missense probably damaging 1.00
R7044:Pikfyve UTSW 1 65,286,013 (GRCm39) missense probably benign 0.01
R7057:Pikfyve UTSW 1 65,286,364 (GRCm39) missense probably benign 0.00
R7525:Pikfyve UTSW 1 65,283,585 (GRCm39) nonsense probably null
R7558:Pikfyve UTSW 1 65,311,782 (GRCm39) missense probably benign 0.01
R7625:Pikfyve UTSW 1 65,307,036 (GRCm39) missense possibly damaging 0.86
R7807:Pikfyve UTSW 1 65,309,101 (GRCm39) missense probably damaging 1.00
R7961:Pikfyve UTSW 1 65,294,293 (GRCm39) missense probably damaging 1.00
R8009:Pikfyve UTSW 1 65,294,293 (GRCm39) missense probably damaging 1.00
R8154:Pikfyve UTSW 1 65,304,948 (GRCm39) missense probably damaging 1.00
R8192:Pikfyve UTSW 1 65,285,554 (GRCm39) missense possibly damaging 0.93
R8275:Pikfyve UTSW 1 65,292,501 (GRCm39) splice site probably benign
R8307:Pikfyve UTSW 1 65,284,894 (GRCm39) missense possibly damaging 0.77
R8710:Pikfyve UTSW 1 65,255,155 (GRCm39) missense possibly damaging 0.94
R8867:Pikfyve UTSW 1 65,283,576 (GRCm39) missense probably damaging 1.00
R8936:Pikfyve UTSW 1 65,310,427 (GRCm39) missense possibly damaging 0.84
R8940:Pikfyve UTSW 1 65,286,129 (GRCm39) missense probably benign 0.00
R8995:Pikfyve UTSW 1 65,244,746 (GRCm39) critical splice acceptor site probably null
R9092:Pikfyve UTSW 1 65,283,559 (GRCm39) missense probably damaging 1.00
R9131:Pikfyve UTSW 1 65,285,239 (GRCm39) missense probably damaging 1.00
R9151:Pikfyve UTSW 1 65,235,898 (GRCm39) missense probably damaging 1.00
R9210:Pikfyve UTSW 1 65,291,719 (GRCm39) missense probably damaging 1.00
R9212:Pikfyve UTSW 1 65,291,719 (GRCm39) missense probably damaging 1.00
R9235:Pikfyve UTSW 1 65,299,188 (GRCm39) missense probably benign 0.37
R9368:Pikfyve UTSW 1 65,307,901 (GRCm39) missense probably damaging 1.00
R9489:Pikfyve UTSW 1 65,303,561 (GRCm39) missense probably benign
R9605:Pikfyve UTSW 1 65,303,561 (GRCm39) missense probably benign
R9686:Pikfyve UTSW 1 65,291,615 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCAAAGCCCTTCATTCCATC -3'
(R):5'- GGTCTCTAAAAGCTTTCATCTGGC -3'

Sequencing Primer
(F):5'- ATTCCATCTTCTGACGGAGGGAC -3'
(R):5'- AAGCTTTCATCTGGCTTTTGGGATC -3'
Posted On 2015-10-21