Incidental Mutation 'R4716:Pkd1'
ID354082
Institutional Source Beutler Lab
Gene Symbol Pkd1
Ensembl Gene ENSMUSG00000032855
Gene Namepolycystin 1, transient receptor poteintial channel interacting
SynonymsPC-1, polycystin-1, PC1
MMRRC Submission 041983-MU
Accession Numbers

Ncbi RefSeq: NM_013630.2; MGI:97603

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4716 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location24549834-24596508 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 24576133 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 2265 (S2265A)
Ref Sequence ENSEMBL: ENSMUSP00000049296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035565] [ENSMUST00000226883]
Predicted Effect probably damaging
Transcript: ENSMUST00000035565
AA Change: S2265A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049296
Gene: ENSMUSG00000032855
AA Change: S2265A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
LRRNT 32 71 1.61e-8 SMART
LRR_TYP 90 113 2.47e-5 SMART
LRRCT 125 177 3.84e-12 SMART
WSC 177 271 6.93e-34 SMART
PKD 272 355 2.72e-15 SMART
CLECT 406 530 5.72e-20 SMART
low complexity region 545 558 N/A INTRINSIC
low complexity region 763 788 N/A INTRINSIC
PKD 930 1008 1.06e-8 SMART
PKD 1015 1119 2.26e-12 SMART
PKD 1122 1205 2.03e-14 SMART
PKD 1208 1288 1.14e-17 SMART
PKD 1290 1373 2.35e-10 SMART
PKD 1374 1459 7.63e-10 SMART
PKD 1464 1541 1.95e-16 SMART
PKD 1544 1625 1.05e-16 SMART
PKD 1631 1714 1.93e-1 SMART
PKD 1716 1798 2.21e-15 SMART
PKD 1799 1882 5.7e-9 SMART
PKD 1884 1964 1.56e-6 SMART
PKD 1968 2056 3.1e-10 SMART
PKD 2057 2140 1.74e-13 SMART
Pfam:REJ 2167 2610 1e-108 PFAM
low complexity region 2697 2706 N/A INTRINSIC
GPS 3003 3052 1.33e-12 SMART
transmembrane domain 3065 3087 N/A INTRINSIC
LH2 3110 3224 3.5e-18 SMART
transmembrane domain 3275 3294 N/A INTRINSIC
transmembrane domain 3314 3336 N/A INTRINSIC
low complexity region 3357 3378 N/A INTRINSIC
low complexity region 3479 3492 N/A INTRINSIC
transmembrane domain 3547 3569 N/A INTRINSIC
low complexity region 3573 3591 N/A INTRINSIC
low complexity region 3626 3639 N/A INTRINSIC
low complexity region 3661 3676 N/A INTRINSIC
Pfam:PKD_channel 3701 4103 7.1e-125 PFAM
low complexity region 4153 4172 N/A INTRINSIC
low complexity region 4238 4256 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226178
Predicted Effect probably benign
Transcript: ENSMUST00000226883
Predicted Effect probably benign
Transcript: ENSMUST00000227107
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype Strain: Several; see below
Lethality: E13-E15
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the polycystin protein family. The encoded glycoprotein contains a large N-terminal extracellular region, multiple transmembrane domains and a cytoplasmic C-tail. It is an integral membrane protein that functions as a regulator of calcium permeable cation channels and intracellular calcium homoeostasis. It is also involved in cell-cell/matrix interactions and may modulate G-protein-coupled signal-transduction pathways. It plays a role in renal tubular development, and mutations in this gene cause autosomal dominant polycystic kidney disease type 1 (ADPKD1). ADPKD1 is characterized by the growth of fluid-filled cysts that replace normal renal tissue and result in end-stage renal failure. Splice variants encoding different isoforms have been noted for this gene. Also, six pseudogenes, closely linked in a known duplicated region on chromosome 16p, have been described. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous mutant embryos begin to die after embryonic day (E) 14.5. They develop edema by E13.5, pancreatic cysts by E15.5 and kidney cysts by E16.5. Heterozygous adults develop cysts of the kidneys (~20-30%) and the liver (~10%) late in life. [provided by MGI curators]
Allele List at MGI

All alleles(32) : Targeted(28) Gene trapped(3) Chemically induced(1)

Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik A G 19: 45,960,342 S233P probably damaging Het
Abi3bp C T 16: 56,650,725 R578* probably null Het
Adam8 T A 7: 139,983,938 D717V probably benign Het
Aknad1 T C 3: 108,775,101 probably null Het
Alk A T 17: 72,205,942 W341R probably damaging Het
Ankdd1b G A 13: 96,454,583 Q101* probably null Het
Anpep A C 7: 79,826,632 S829A probably benign Het
Ate1 A T 7: 130,513,781 C72S probably damaging Het
Atp6v0a4 G A 6: 38,061,064 L533F probably damaging Het
Bach1 T C 16: 87,715,379 probably benign Het
Baz2b T C 2: 59,969,255 D240G probably benign Het
Cdc14b C T 13: 64,209,200 S21N probably damaging Het
Cdh3 A G 8: 106,543,888 I466V probably benign Het
Cog1 A G 11: 113,657,097 E137G probably damaging Het
Col4a2 A G 8: 11,402,224 D180G probably damaging Het
Cyp2c40 A T 19: 39,802,661 probably null Het
Dclk2 C T 3: 86,919,881 R97H probably damaging Het
Ddx52 T C 11: 83,955,205 probably null Het
Dhx58 C T 11: 100,696,971 probably null Het
Dmp1 T A 5: 104,212,561 S368T probably damaging Het
Dnah17 C A 11: 118,073,648 V2435L probably benign Het
Dnajc7 A G 11: 100,619,576 V10A probably benign Het
Dscam G T 16: 96,619,571 T1705K possibly damaging Het
Dscaml1 G A 9: 45,450,592 V217M probably damaging Het
Dync2h1 A G 9: 7,142,648 probably null Het
F5 A G 1: 164,193,919 D1321G probably damaging Het
Fam174a C T 1: 95,314,045 P77S probably benign Het
Fars2 G A 13: 36,205,068 R180H probably damaging Het
Fnbp1 T C 2: 31,055,520 T154A probably benign Het
Fsip2 T A 2: 82,974,859 N507K probably damaging Het
Glg1 G T 8: 111,160,775 Y449* probably null Het
Gm15130 A T 2: 111,134,215 Y187* probably null Het
Gm973 A T 1: 59,552,554 K366* probably null Het
Hao1 A G 2: 134,505,620 I255T probably damaging Het
Herc6 T A 6: 57,598,438 V148E probably damaging Het
Hist1h2bj T A 13: 22,043,363 V45E possibly damaging Het
Insm2 T A 12: 55,600,892 C474S possibly damaging Het
Itch T C 2: 155,210,582 probably null Het
Itga2 A G 13: 114,857,373 V748A probably damaging Het
Itga9 T A 9: 118,681,758 S452T probably damaging Het
Kdm4b C A 17: 56,386,178 D338E probably benign Het
Krt40 G A 11: 99,540,219 R155C probably damaging Het
Krtap16-1 A G 11: 99,985,174 V468A probably damaging Het
Lactb2 G A 1: 13,638,395 P143L probably damaging Het
Lrba C A 3: 86,642,714 T2330K probably damaging Het
Lrp2bp A T 8: 46,013,171 I106F probably benign Het
Luzp2 A G 7: 54,835,962 K2E probably damaging Het
Lypd6 T C 2: 50,188,843 probably null Het
Maml1 A T 11: 50,257,867 D1015E probably benign Het
Mdfi T G 17: 47,820,981 D106A possibly damaging Het
Olfm3 T C 3: 115,081,106 M17T probably benign Het
Olfr136 A C 17: 38,335,840 I228L possibly damaging Het
Olfr1394 A G 11: 49,160,890 Y292C probably damaging Het
Olfr894 T A 9: 38,219,418 N198K probably damaging Het
Olfr948 A G 9: 39,319,429 F62L probably benign Het
Otud7b T G 3: 96,150,910 L261V probably damaging Het
P2ry1 A G 3: 61,003,472 N11D probably damaging Het
Pate2 T C 9: 35,685,682 probably benign Het
Pcdhb16 A T 18: 37,479,405 T473S probably benign Het
Per1 A G 11: 69,101,231 E137G probably damaging Het
Phf11d T C 14: 59,353,342 T189A probably benign Het
Pik3r5 C A 11: 68,495,204 S738R possibly damaging Het
Pikfyve A G 1: 65,246,476 Y913C possibly damaging Het
Pkhd1l1 C A 15: 44,556,032 N2964K probably damaging Het
Plch1 T G 3: 63,781,546 D79A probably damaging Het
Pnliprp1 A C 19: 58,740,469 T363P possibly damaging Het
Ppp1r10 T A 17: 35,929,460 D547E probably benign Het
Prkdc T A 16: 15,810,837 I3482K probably benign Het
Ptpn4 A G 1: 119,721,868 Y333H probably damaging Het
Ptpru T A 4: 131,820,968 M73L probably benign Het
Rrp12 A G 19: 41,877,428 Y698H probably damaging Het
Scaf8 T C 17: 3,177,123 F338L unknown Het
Slc17a1 G T 13: 23,880,593 V347L probably benign Het
Slc1a2 T A 2: 102,748,538 V263E probably damaging Het
Slc29a4 T C 5: 142,718,572 V327A probably benign Het
Slc6a3 A C 13: 73,557,076 I229L probably benign Het
Sos2 T C 12: 69,607,371 I703V probably benign Het
Srpk1 T C 17: 28,622,008 T15A probably benign Het
St6gal2 A T 17: 55,510,366 Q510L probably benign Het
Stk24 T C 14: 121,294,718 D289G possibly damaging Het
Taf2 T G 15: 55,065,968 K64T probably benign Het
Tbx3 A G 5: 119,675,670 E257G possibly damaging Het
Tmem102 A T 11: 69,804,196 F317I probably damaging Het
Trav10 A G 14: 53,506,040 S33G possibly damaging Het
Ttn T A 2: 76,915,064 I5214F probably damaging Het
Ube2f T A 1: 91,254,280 L2Q probably damaging Het
Ube4b A G 4: 149,344,612 F857L probably damaging Het
Vmn2r18 T A 5: 151,562,137 I631F possibly damaging Het
Zfp280d T A 9: 72,312,665 S241T possibly damaging Het
Zfp638 T A 6: 83,979,562 L1717* probably null Het
Zfp719 A G 7: 43,591,111 N708D possibly damaging Het
Other mutations in Pkd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Pkd1 APN 17 24580095 missense probably damaging 1.00
IGL00503:Pkd1 APN 17 24565427 missense probably benign
IGL00549:Pkd1 APN 17 24572761 missense probably benign
IGL00573:Pkd1 APN 17 24594530 nonsense probably null
IGL00924:Pkd1 APN 17 24571627 nonsense probably null
IGL01319:Pkd1 APN 17 24587919 unclassified probably benign
IGL01326:Pkd1 APN 17 24576174 nonsense probably null
IGL01457:Pkd1 APN 17 24594821 unclassified probably null
IGL01541:Pkd1 APN 17 24586298 missense probably damaging 1.00
IGL01575:Pkd1 APN 17 24573128 missense probably damaging 1.00
IGL01606:Pkd1 APN 17 24576523 missense probably damaging 0.97
IGL01642:Pkd1 APN 17 24581292 missense probably damaging 1.00
IGL01888:Pkd1 APN 17 24585815 missense possibly damaging 0.91
IGL01940:Pkd1 APN 17 24579746 missense possibly damaging 0.63
IGL01958:Pkd1 APN 17 24580324 missense probably damaging 1.00
IGL02005:Pkd1 APN 17 24586004 missense possibly damaging 0.67
IGL02121:Pkd1 APN 17 24575927 missense probably benign 0.03
IGL02148:Pkd1 APN 17 24579836 missense probably damaging 1.00
IGL02409:Pkd1 APN 17 24573623 missense probably benign 0.01
IGL02442:Pkd1 APN 17 24565226 missense probably benign 0.41
IGL02498:Pkd1 APN 17 24585779 missense possibly damaging 0.91
IGL02501:Pkd1 APN 17 24569699 missense probably benign 0.01
IGL02551:Pkd1 APN 17 24573815 missense probably damaging 1.00
IGL02635:Pkd1 APN 17 24572811 missense probably damaging 1.00
IGL02673:Pkd1 APN 17 24571283 missense probably benign 0.40
IGL02808:Pkd1 APN 17 24593504 missense probably damaging 1.00
IGL02816:Pkd1 APN 17 24594515 missense probably benign 0.00
IGL02863:Pkd1 APN 17 24569752 missense possibly damaging 0.56
IGL02927:Pkd1 APN 17 24575189 missense probably damaging 1.00
IGL02961:Pkd1 APN 17 24578115 missense possibly damaging 0.81
IGL03003:Pkd1 APN 17 24593603 critical splice donor site probably null
IGL03066:Pkd1 APN 17 24586234 missense probably damaging 1.00
IGL03182:Pkd1 APN 17 24573818 missense probably damaging 0.98
IGL03384:Pkd1 APN 17 24565897 missense probably benign 0.00
IGL03404:Pkd1 APN 17 24564406 missense probably damaging 0.97
PIT1430001:Pkd1 UTSW 17 24569511 missense probably damaging 0.99
PIT4494001:Pkd1 UTSW 17 24577801 missense probably damaging 1.00
PIT4677001:Pkd1 UTSW 17 24574029 missense possibly damaging 0.94
R0017:Pkd1 UTSW 17 24578539 critical splice donor site probably null
R0017:Pkd1 UTSW 17 24578539 critical splice donor site probably null
R0022:Pkd1 UTSW 17 24594819 missense probably damaging 0.98
R0022:Pkd1 UTSW 17 24594819 missense probably damaging 0.98
R0058:Pkd1 UTSW 17 24564703 missense probably benign 0.06
R0058:Pkd1 UTSW 17 24564703 missense probably benign 0.06
R0085:Pkd1 UTSW 17 24586223 missense probably damaging 0.98
R0094:Pkd1 UTSW 17 24581276 missense possibly damaging 0.80
R0094:Pkd1 UTSW 17 24581276 missense possibly damaging 0.80
R0135:Pkd1 UTSW 17 24565071 missense possibly damaging 0.85
R0304:Pkd1 UTSW 17 24585946 missense probably damaging 1.00
R0427:Pkd1 UTSW 17 24593502 missense probably damaging 0.98
R0502:Pkd1 UTSW 17 24574792 missense probably damaging 0.99
R0518:Pkd1 UTSW 17 24595219 missense probably benign 0.01
R0521:Pkd1 UTSW 17 24595219 missense probably benign 0.01
R0544:Pkd1 UTSW 17 24585683 missense probably damaging 1.00
R0546:Pkd1 UTSW 17 24580138 missense probably benign 0.44
R0626:Pkd1 UTSW 17 24575575 missense probably damaging 0.96
R0648:Pkd1 UTSW 17 24594937 missense probably damaging 1.00
R1138:Pkd1 UTSW 17 24586032 missense probably damaging 1.00
R1302:Pkd1 UTSW 17 24568236 missense probably benign 0.00
R1306:Pkd1 UTSW 17 24573172 missense probably damaging 0.97
R1349:Pkd1 UTSW 17 24575266 missense probably damaging 1.00
R1372:Pkd1 UTSW 17 24575266 missense probably damaging 1.00
R1437:Pkd1 UTSW 17 24595132 missense probably damaging 1.00
R1515:Pkd1 UTSW 17 24594853 missense probably benign 0.01
R1605:Pkd1 UTSW 17 24577526 missense possibly damaging 0.95
R1622:Pkd1 UTSW 17 24581640 missense probably benign
R1623:Pkd1 UTSW 17 24578269 missense probably damaging 0.99
R1726:Pkd1 UTSW 17 24564176 missense probably damaging 0.96
R1756:Pkd1 UTSW 17 24594485 missense probably damaging 1.00
R1780:Pkd1 UTSW 17 24581569 missense probably benign
R1785:Pkd1 UTSW 17 24591099 missense probably benign 0.00
R1829:Pkd1 UTSW 17 24565584 missense probably benign
R1869:Pkd1 UTSW 17 24594931 missense probably damaging 1.00
R1920:Pkd1 UTSW 17 24595157 missense probably damaging 0.99
R1922:Pkd1 UTSW 17 24595157 missense probably damaging 0.99
R1987:Pkd1 UTSW 17 24576592 splice site probably null
R1988:Pkd1 UTSW 17 24576592 splice site probably null
R1998:Pkd1 UTSW 17 24573014 missense probably damaging 1.00
R2007:Pkd1 UTSW 17 24579785 missense probably damaging 1.00
R2019:Pkd1 UTSW 17 24568684 nonsense probably null
R2054:Pkd1 UTSW 17 24574796 missense probably benign 0.00
R2061:Pkd1 UTSW 17 24569914 missense possibly damaging 0.89
R2196:Pkd1 UTSW 17 24580072 missense possibly damaging 0.60
R2203:Pkd1 UTSW 17 24580889 missense probably benign 0.01
R2301:Pkd1 UTSW 17 24574612 missense probably benign
R2655:Pkd1 UTSW 17 24576490 missense probably damaging 0.99
R2860:Pkd1 UTSW 17 24565446 missense probably benign 0.43
R2861:Pkd1 UTSW 17 24565446 missense probably benign 0.43
R3000:Pkd1 UTSW 17 24594486 missense probably damaging 1.00
R3150:Pkd1 UTSW 17 24579791 missense probably benign 0.00
R3747:Pkd1 UTSW 17 24591461 missense possibly damaging 0.67
R3812:Pkd1 UTSW 17 24565641 missense probably benign 0.00
R3859:Pkd1 UTSW 17 24578092 splice site probably benign
R3893:Pkd1 UTSW 17 24572110 critical splice donor site probably null
R3947:Pkd1 UTSW 17 24578037 splice site probably benign
R3949:Pkd1 UTSW 17 24578037 splice site probably benign
R4176:Pkd1 UTSW 17 24587997 missense probably benign 0.17
R4199:Pkd1 UTSW 17 24570030 missense probably benign 0.41
R4225:Pkd1 UTSW 17 24593523 missense possibly damaging 0.50
R4439:Pkd1 UTSW 17 24585692 missense probably damaging 1.00
R4476:Pkd1 UTSW 17 24576526 missense probably damaging 1.00
R4801:Pkd1 UTSW 17 24578096 missense probably damaging 1.00
R4802:Pkd1 UTSW 17 24578096 missense probably damaging 1.00
R4817:Pkd1 UTSW 17 24565374 unclassified probably null
R4903:Pkd1 UTSW 17 24572002 missense probably benign 0.30
R4910:Pkd1 UTSW 17 24572687 missense probably damaging 1.00
R4964:Pkd1 UTSW 17 24586068 critical splice donor site probably null
R4966:Pkd1 UTSW 17 24586068 critical splice donor site probably null
R5040:Pkd1 UTSW 17 24571260 missense probably benign 0.02
R5042:Pkd1 UTSW 17 24569887 missense probably benign 0.00
R5088:Pkd1 UTSW 17 24590838 missense possibly damaging 0.94
R5121:Pkd1 UTSW 17 24573463 missense probably benign
R5296:Pkd1 UTSW 17 24576074 missense probably damaging 1.00
R5338:Pkd1 UTSW 17 24594536 missense probably benign
R5356:Pkd1 UTSW 17 24593577 missense probably damaging 0.97
R5357:Pkd1 UTSW 17 24565790 missense probably damaging 1.00
R5363:Pkd1 UTSW 17 24565073 missense probably benign
R5383:Pkd1 UTSW 17 24574375 missense probably benign
R5622:Pkd1 UTSW 17 24574040 missense possibly damaging 0.67
R5651:Pkd1 UTSW 17 24591387 missense possibly damaging 0.88
R5664:Pkd1 UTSW 17 24569371 missense probably damaging 0.99
R5723:Pkd1 UTSW 17 24565523 missense probably benign 0.01
R5797:Pkd1 UTSW 17 24592641 missense possibly damaging 0.55
R5838:Pkd1 UTSW 17 24580212 missense possibly damaging 0.75
R5866:Pkd1 UTSW 17 24580961 missense probably damaging 0.99
R5873:Pkd1 UTSW 17 24569830 missense probably benign
R5906:Pkd1 UTSW 17 24572920 missense probably benign 0.16
R6047:Pkd1 UTSW 17 24595085 missense probably damaging 1.00
R6076:Pkd1 UTSW 17 24581030 missense probably benign 0.14
R6151:Pkd1 UTSW 17 24575606 missense probably benign 0.00
R6252:Pkd1 UTSW 17 24581226 missense probably damaging 0.98
R6341:Pkd1 UTSW 17 24580227 missense probably damaging 1.00
R6540:Pkd1 UTSW 17 24575977 missense probably damaging 1.00
R6732:Pkd1 UTSW 17 24569413 missense probably damaging 1.00
R6836:Pkd1 UTSW 17 24581259 missense probably damaging 1.00
R6856:Pkd1 UTSW 17 24573493 missense probably benign 0.05
R6865:Pkd1 UTSW 17 24576487 missense probably benign 0.43
R6999:Pkd1 UTSW 17 24578501 missense possibly damaging 0.62
R7077:Pkd1 UTSW 17 24591119 missense probably damaging 1.00
R7123:Pkd1 UTSW 17 24594768 missense possibly damaging 0.89
R7134:Pkd1 UTSW 17 24594112 missense probably damaging 0.99
R7210:Pkd1 UTSW 17 24575866 missense probably damaging 0.98
R7323:Pkd1 UTSW 17 24575051 missense probably benign 0.01
R7380:Pkd1 UTSW 17 24581642 missense probably damaging 1.00
X0024:Pkd1 UTSW 17 24591392 missense possibly damaging 0.68
X0061:Pkd1 UTSW 17 24594931 missense probably damaging 1.00
X0065:Pkd1 UTSW 17 24586164 missense probably benign 0.19
Z1088:Pkd1 UTSW 17 24565605 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- TCAAATGGTACTGCCTGGTG -3'
(R):5'- GGAATAACCCAAGTGCTAGGC -3'

Sequencing Primer
(F):5'- TGTGGATGTGAGCCGACC -3'
(R):5'- GCTAGGCACTTAATAGACATGAAAC -3'
Posted On2015-10-21