Incidental Mutation 'R4717:Tie1'
ID354113
Institutional Source Beutler Lab
Gene Symbol Tie1
Ensembl Gene ENSMUSG00000033191
Gene Nametyrosine kinase with immunoglobulin-like and EGF-like domains 1
SynonymsTIE, D430008P04Rik, tie-1
MMRRC Submission 041984-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4717 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location118471191-118490061 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 118486217 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 150 (K150E)
Ref Sequence ENSEMBL: ENSMUSP00000139279 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047421] [ENSMUST00000184261]
Predicted Effect probably benign
Transcript: ENSMUST00000047421
AA Change: K150E

PolyPhen 2 Score 0.223 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000037129
Gene: ENSMUSG00000033191
AA Change: K150E

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IG 129 211 1.58e-1 SMART
EGF 221 254 1.47e-3 SMART
EGF_like 265 301 7.23e1 SMART
EGF 312 343 8.52e0 SMART
IG 355 442 1.92e0 SMART
FN3 445 528 2.68e-2 SMART
FN3 544 627 4.1e0 SMART
FN3 640 722 6.95e-10 SMART
transmembrane domain 760 782 N/A INTRINSIC
TyrKc 835 1103 5.05e-134 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117834
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153286
Predicted Effect probably damaging
Transcript: ENSMUST00000184261
AA Change: K150E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139279
Gene: ENSMUSG00000033191
AA Change: K150E

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IG 129 211 1.58e-1 SMART
EGF 221 254 1.47e-3 SMART
EGF_like 265 301 7.23e1 SMART
EGF 312 343 8.52e0 SMART
IG 355 442 1.92e0 SMART
FN3 445 528 2.68e-2 SMART
FN3 544 627 4.1e0 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tyrosine protein kinase family. The encoded protein plays a critical role in angiogenesis and blood vessel stability by inhibiting angiopoietin 1 signaling through the endothelial receptor tyrosine kinase Tie2. Ectodomain cleavage of the encoded protein relieves inhibition of Tie2 and is mediated by multiple factors including vascular endothelial growth factor. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous mutation of this gene results in embryonic or neonatal lethality, hemorrhages, edema, increased vascular branching, and abnormal vascular endothelial cell development. Mice homozygous for a hypomorphic allele exhibit dilated and disorganized lymphatic vessel, edema, and hemorrhage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik T C 10: 29,221,787 L60P probably damaging Het
Acsf2 T G 11: 94,559,546 M512L probably benign Het
Ahrr T A 13: 74,215,766 H312L probably benign Het
Akr1c18 T C 13: 4,136,718 M244V probably benign Het
Aldh3b2 A G 19: 3,981,128 Y459C probably damaging Het
Arhgap29 A T 3: 122,009,958 I796L possibly damaging Het
Arrdc4 T A 7: 68,741,658 D287V probably damaging Het
Astn2 A T 4: 65,644,754 I930N possibly damaging Het
Bace2 T A 16: 97,436,873 L508Q probably damaging Het
Baz2a G T 10: 128,124,942 C1537F possibly damaging Het
Cad A G 5: 31,066,686 probably null Het
Capn5 A T 7: 98,123,919 I626N probably benign Het
Car8 A T 4: 8,169,685 N274K probably damaging Het
Casp14 T C 10: 78,715,124 I76V probably benign Het
Ccdc88c A G 12: 100,916,666 V1649A probably benign Het
Cemip A T 7: 83,947,280 I1092N probably damaging Het
Clspn A G 4: 126,560,056 N91D probably damaging Het
Cpxm2 A G 7: 132,054,845 Y563H possibly damaging Het
Csnk1g2 T C 10: 80,637,915 V72A probably benign Het
Cyp46a1 T C 12: 108,352,026 probably null Het
Cyp4x1 T C 4: 115,121,705 H206R probably benign Het
Dapk1 T A 13: 60,726,662 probably null Het
Ddx1 A G 12: 13,240,887 W76R probably damaging Het
Dhx29 G A 13: 112,946,935 R508H unknown Het
Dnah2 T C 11: 69,429,357 D3962G probably benign Het
Dnajc14 T A 10: 128,806,244 C12S possibly damaging Het
Dock1 T C 7: 134,848,170 I804T probably damaging Het
Efs G T 14: 54,920,344 S170Y probably damaging Het
Eml4 G T 17: 83,448,225 W295C probably benign Het
Fkbp15 A G 4: 62,308,069 S748P probably damaging Het
Ghr T G 15: 3,319,753 I648L possibly damaging Het
Gigyf1 T A 5: 137,525,232 I942N probably damaging Het
Gm960 A G 19: 4,625,873 probably benign Het
Gpam T A 19: 55,075,614 E682D probably benign Het
Gsr A T 8: 33,693,858 K383* probably null Het
Hapln1 C A 13: 89,605,460 S248R probably benign Het
Haus2 G T 2: 120,619,102 R209L probably benign Het
Hhatl A G 9: 121,789,877 F63S probably damaging Het
Hmcn1 A G 1: 150,619,065 M4091T probably benign Het
Hspb7 A G 4: 141,422,585 D94G probably damaging Het
Irf6 T A 1: 193,167,434 probably null Het
Itgb2 T A 10: 77,546,044 L60* probably null Het
Jmjd1c C T 10: 67,158,051 Q104* probably null Het
Kcnh1 A G 1: 192,276,717 D193G probably damaging Het
Klhl25 G T 7: 75,866,780 C478F probably damaging Het
Klhl3 T C 13: 58,030,516 D267G probably damaging Het
L3mbtl4 T G 17: 68,455,713 H80Q probably null Het
Lhcgr C A 17: 88,742,467 V544F probably benign Het
Mfsd4a T C 1: 132,057,895 N168D probably benign Het
Mmp3 A G 9: 7,449,881 Q255R possibly damaging Het
Mrgprb3 C A 7: 48,643,252 G184C probably benign Het
Mtpap C T 18: 4,396,394 A562V possibly damaging Het
Nid1 T C 13: 13,506,501 V1072A probably benign Het
Nsf T G 11: 103,823,769 K728T probably damaging Het
Olfr1328 T C 4: 118,934,429 N140D probably benign Het
Olfr23 T A 11: 73,940,815 S190T possibly damaging Het
Olfr448 T C 6: 42,897,224 Y258H probably damaging Het
Olfr530 T C 7: 140,373,415 N65S probably damaging Het
Olfr725 A T 14: 50,035,364 V13E probably damaging Het
Pcsk5 A T 19: 17,525,267 C894S probably damaging Het
Pde2a A G 7: 101,494,672 D166G probably benign Het
Pfpl G A 19: 12,429,254 E290K probably benign Het
Pi4kb A C 3: 94,998,851 I570L probably damaging Het
Plxnb2 A T 15: 89,157,419 C1727* probably null Het
Poln A T 5: 34,129,448 D125E possibly damaging Het
Pomgnt1 A G 4: 116,154,215 D259G possibly damaging Het
Prx A T 7: 27,516,727 M218L probably benign Het
Pxn A T 5: 115,551,942 Q342L probably damaging Het
Rhpn2 A G 7: 35,334,350 D3G possibly damaging Het
Rnase2b C T 14: 51,162,717 T85I possibly damaging Het
Rnaseh2b C A 14: 62,353,626 T142K probably damaging Het
Sacs T C 14: 61,212,855 S4117P probably damaging Het
Sdk2 T C 11: 113,854,369 N700S probably damaging Het
Sec62 A C 3: 30,809,871 K101Q unknown Het
Sel1l2 A C 2: 140,230,023 L659R possibly damaging Het
Sept11 A G 5: 93,156,956 I211V possibly damaging Het
Slc25a42 C T 8: 70,189,457 E112K probably damaging Het
Spem2 T C 11: 69,817,783 N119D probably benign Het
Themis G A 10: 28,789,752 E604K probably benign Het
Ubap2 G A 4: 41,218,333 T258I possibly damaging Het
Ushbp1 C T 8: 71,385,669 A664T probably damaging Het
Vmn1r1 T C 1: 182,157,209 N297S possibly damaging Het
Vmn1r173 A C 7: 23,703,212 I291L probably damaging Het
Yy1 A G 12: 108,794,046 I212V possibly damaging Het
Zfp442 A T 2: 150,408,229 F527L probably damaging Het
Zyg11b T A 4: 108,241,872 H632L probably damaging Het
Other mutations in Tie1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01419:Tie1 APN 4 118476098 missense probably damaging 1.00
IGL01679:Tie1 APN 4 118482739 missense probably benign 0.00
IGL01821:Tie1 APN 4 118484638 missense probably damaging 0.99
IGL01892:Tie1 APN 4 118475918 missense probably benign
IGL02101:Tie1 APN 4 118472798 missense probably benign 0.42
IGL02411:Tie1 APN 4 118486563 nonsense probably null
IGL02421:Tie1 APN 4 118486394 missense probably damaging 1.00
IGL02892:Tie1 APN 4 118486282 missense probably damaging 1.00
IGL03294:Tie1 APN 4 118480223 missense probably damaging 1.00
IGL03346:Tie1 APN 4 118472828 missense probably damaging 1.00
R0064:Tie1 UTSW 4 118489701 missense possibly damaging 0.94
R0067:Tie1 UTSW 4 118476280 splice site probably benign
R0080:Tie1 UTSW 4 118484353 missense probably damaging 1.00
R0082:Tie1 UTSW 4 118484353 missense probably damaging 1.00
R0098:Tie1 UTSW 4 118486587 missense probably benign
R0329:Tie1 UTSW 4 118484727 missense probably benign 0.24
R0330:Tie1 UTSW 4 118484727 missense probably benign 0.24
R0410:Tie1 UTSW 4 118480569 missense probably damaging 1.00
R0472:Tie1 UTSW 4 118476147 missense possibly damaging 0.61
R0498:Tie1 UTSW 4 118479161 utr 3 prime probably benign
R0521:Tie1 UTSW 4 118476146 missense probably damaging 1.00
R0609:Tie1 UTSW 4 118476147 missense possibly damaging 0.61
R0675:Tie1 UTSW 4 118479769 nonsense probably null
R0830:Tie1 UTSW 4 118482663 missense probably damaging 1.00
R1541:Tie1 UTSW 4 118483873 missense probably damaging 0.99
R1604:Tie1 UTSW 4 118474407 missense probably damaging 1.00
R1731:Tie1 UTSW 4 118476263 missense probably damaging 1.00
R1751:Tie1 UTSW 4 118476176 missense possibly damaging 0.87
R1767:Tie1 UTSW 4 118476176 missense possibly damaging 0.87
R1953:Tie1 UTSW 4 118472790 critical splice donor site probably null
R1986:Tie1 UTSW 4 118478963 missense probably benign
R2141:Tie1 UTSW 4 118472811 nonsense probably null
R3150:Tie1 UTSW 4 118475825 missense probably damaging 1.00
R4235:Tie1 UTSW 4 118478405 nonsense probably null
R4599:Tie1 UTSW 4 118472634 missense probably benign 0.00
R4614:Tie1 UTSW 4 118479051 missense probably damaging 1.00
R4623:Tie1 UTSW 4 118486611 missense possibly damaging 0.71
R4638:Tie1 UTSW 4 118483842 missense probably benign 0.00
R4936:Tie1 UTSW 4 118484771 splice site silent
R4983:Tie1 UTSW 4 118483755 missense probably damaging 1.00
R5202:Tie1 UTSW 4 118480510 missense probably benign 0.01
R5234:Tie1 UTSW 4 118482762 missense probably benign 0.22
R5243:Tie1 UTSW 4 118482351 missense probably damaging 0.99
R5538:Tie1 UTSW 4 118486193 missense probably benign 0.10
R5881:Tie1 UTSW 4 118475603 missense possibly damaging 0.89
R6045:Tie1 UTSW 4 118484691 missense probably benign 0.05
R6073:Tie1 UTSW 4 118482390 missense probably benign
R6476:Tie1 UTSW 4 118472865 missense possibly damaging 0.82
R6820:Tie1 UTSW 4 118484386 missense probably damaging 1.00
R6961:Tie1 UTSW 4 118486205 missense probably damaging 1.00
R7022:Tie1 UTSW 4 118489653 missense probably benign 0.00
R7029:Tie1 UTSW 4 118484626 missense possibly damaging 0.93
R7147:Tie1 UTSW 4 118484413 missense probably damaging 1.00
R7249:Tie1 UTSW 4 118486228 missense probably benign 0.29
Z1088:Tie1 UTSW 4 118484429 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGCTCCTGGTCCTTTTAG -3'
(R):5'- CTCTATGTGCACAACAGCCCAG -3'

Sequencing Primer
(F):5'- AGGCTCCTGGTCCTTTTAGTACAG -3'
(R):5'- AGGGGGTGAGTCTGGCCTAC -3'
Posted On2015-10-21