Incidental Mutation 'R4718:Dnajb3'
ID354183
Institutional Source Beutler Lab
Gene Symbol Dnajb3
Ensembl Gene ENSMUSG00000081984
Gene NameDnaJ heat shock protein family (Hsp40) member B3
SynonymsMSJ-1, Hsj3, Msj1
MMRRC Submission 041985-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.333) question?
Stock #R4718 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location88204732-88205782 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 88205339 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 114 (D114N)
Ref Sequence ENSEMBL: ENSMUSP00000112703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014263] [ENSMUST00000049289] [ENSMUST00000058237] [ENSMUST00000073772] [ENSMUST00000097659] [ENSMUST00000113134] [ENSMUST00000113135] [ENSMUST00000113137] [ENSMUST00000113138] [ENSMUST00000113139] [ENSMUST00000113142] [ENSMUST00000119972] [ENSMUST00000126203] [ENSMUST00000138182] [ENSMUST00000140092] [ENSMUST00000150634] [ENSMUST00000173325]
Predicted Effect probably benign
Transcript: ENSMUST00000014263
SMART Domains Protein: ENSMUSP00000014263
Gene: ENSMUSG00000054545

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:UDPGT 27 522 1.2e-229 PFAM
Pfam:Glyco_tran_28_C 363 448 1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000049289
SMART Domains Protein: ENSMUSP00000037258
Gene: ENSMUSG00000090171

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:UDPGT 28 524 2.2e-247 PFAM
Pfam:Glyco_tran_28_C 363 452 4.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000058237
SMART Domains Protein: ENSMUSP00000058683
Gene: ENSMUSG00000090124

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 522 1.5e-234 PFAM
Pfam:Glyco_tran_28_C 361 450 4.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000073772
SMART Domains Protein: ENSMUSP00000073444
Gene: ENSMUSG00000090175

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:UDPGT 24 519 2.3e-232 PFAM
Pfam:Glyco_tran_28_C 358 447 4.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097659
SMART Domains Protein: ENSMUSP00000095263
Gene: ENSMUSG00000089943

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:UDPGT 25 520 6.7e-246 PFAM
Pfam:Glyco_tran_28_C 359 448 1.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113134
SMART Domains Protein: ENSMUSP00000108759
Gene: ENSMUSG00000054545

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:UDPGT 27 522 2.7e-232 PFAM
Pfam:Glyco_tran_28_C 361 450 4.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113135
SMART Domains Protein: ENSMUSP00000108760
Gene: ENSMUSG00000090124

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:UDPGT 27 522 1.2e-229 PFAM
Pfam:Glyco_tran_28_C 363 448 1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113137
SMART Domains Protein: ENSMUSP00000108762
Gene: ENSMUSG00000090145

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:UDPGT 27 522 1.3e-231 PFAM
Pfam:Glyco_tran_28_C 361 450 2.8e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113138
SMART Domains Protein: ENSMUSP00000108763
Gene: ENSMUSG00000090145

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:UDPGT 27 522 7.3e-229 PFAM
Pfam:Glyco_tran_28_C 363 448 6.6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113139
SMART Domains Protein: ENSMUSP00000108764
Gene: ENSMUSG00000089675

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 521 3.6e-237 PFAM
Pfam:Glyco_tran_28_C 360 449 1.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113142
SMART Domains Protein: ENSMUSP00000108767
Gene: ENSMUSG00000090165

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 521 7.3e-231 PFAM
Pfam:Glyco_tran_28_C 360 449 1.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119972
AA Change: D114N

PolyPhen 2 Score 0.132 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000112703
Gene: ENSMUSG00000081984
AA Change: D114N

DomainStartEndE-ValueType
DnaJ 2 61 6.22e-33 SMART
low complexity region 69 81 N/A INTRINSIC
low complexity region 104 119 N/A INTRINSIC
low complexity region 126 138 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124852
Predicted Effect probably benign
Transcript: ENSMUST00000126203
SMART Domains Protein: ENSMUSP00000116653
Gene: ENSMUSG00000090124

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 62 4.6e-11 PFAM
Pfam:UDPGT 59 127 8.9e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138182
SMART Domains Protein: ENSMUSP00000119985
Gene: ENSMUSG00000090165

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 62 7e-11 PFAM
Pfam:UDPGT 58 207 1.9e-90 PFAM
Pfam:Glyco_tran_28_C 137 207 4.8e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140092
SMART Domains Protein: ENSMUSP00000115642
Gene: ENSMUSG00000054545

DomainStartEndE-ValueType
Pfam:UDPGT 1 166 9.3e-98 PFAM
Pfam:Glyco_tran_28_C 96 166 4.9e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150634
SMART Domains Protein: ENSMUSP00000123452
Gene: ENSMUSG00000090124

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 62 9.5e-11 PFAM
Pfam:UDPGT 58 207 2e-90 PFAM
Pfam:Glyco_tran_28_C 137 207 4.8e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173165
Predicted Effect probably benign
Transcript: ENSMUST00000173325
SMART Domains Protein: ENSMUSP00000134443
Gene: ENSMUSG00000090165

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:UDPGT 26 61 3.4e-10 PFAM
Pfam:UDPGT 59 210 8.9e-92 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930519G04Rik G A 5: 114,863,554 probably null Het
Acsm2 A T 7: 119,573,603 Y147F probably damaging Het
Alg12 A T 15: 88,806,053 Y413N probably damaging Het
Arntl A T 7: 113,303,361 I399F probably damaging Het
Arrdc3 A T 13: 80,883,867 Q73L possibly damaging Het
Atp13a5 T C 16: 29,248,170 K1017E probably damaging Het
Bms1 T C 6: 118,403,235 N704D possibly damaging Het
Bsph1 T A 7: 13,472,182 Y47* probably null Het
Crat A T 2: 30,408,164 Y174* probably null Het
Csmd3 G T 15: 47,698,150 Y2254* probably null Het
Cyld T A 8: 88,742,305 I568N probably damaging Het
Dapl1 T C 2: 59,484,728 V7A probably benign Het
Dhx29 G A 13: 112,946,935 R508H unknown Het
Dnah9 A G 11: 66,085,473 I1250T probably benign Het
Dsg1b A G 18: 20,397,929 N446D probably damaging Het
Dthd1 T A 5: 62,818,793 V270E probably damaging Het
F2rl3 A C 8: 72,762,908 R254S possibly damaging Het
Fam208b A T 13: 3,574,495 D1818E probably benign Het
Fgfr2 A G 7: 130,261,788 S24P probably damaging Het
Fpr2 T C 17: 17,893,336 V198A probably benign Het
Gbp2b G A 3: 142,598,995 G64D probably damaging Het
Gbp9 T G 5: 105,083,758 N321H probably damaging Het
Gk2 T A 5: 97,455,866 Y371F probably benign Het
Gm10382 T C 5: 125,389,398 probably benign Het
Gpatch3 A G 4: 133,582,544 D396G probably benign Het
Heatr5a A C 12: 51,916,163 L985V possibly damaging Het
Homer1 T A 13: 93,391,764 V269E probably damaging Het
Hspbap1 T C 16: 35,787,322 V66A probably benign Het
Ighv7-2 A C 12: 113,912,469 I5M possibly damaging Het
Ints7 T A 1: 191,583,277 F108Y possibly damaging Het
Itga7 CT CTGGGGATT 10: 128,940,734 probably null Het
Junb G A 8: 84,978,432 probably benign Het
Lcp2 A G 11: 34,070,992 N116S probably benign Het
Lrguk A G 6: 34,029,496 T14A probably benign Het
Lrrcc1 T A 3: 14,536,032 H41Q probably damaging Het
Ltb C A 17: 35,195,337 probably null Het
Mapk7 A G 11: 61,489,254 S693P possibly damaging Het
Mbd5 A T 2: 49,256,402 H208L possibly damaging Het
Megf9 A T 4: 70,448,778 S322R possibly damaging Het
Mgat4c T C 10: 102,388,606 V227A probably damaging Het
Mospd3 G A 5: 137,599,653 T151M probably benign Het
Mpl A G 4: 118,456,724 S115P probably benign Het
Myo6 C A 9: 80,246,517 D258E probably benign Het
N4bp2 G A 5: 65,803,463 M492I probably damaging Het
Ndst3 G A 3: 123,672,266 A19V probably benign Het
Nkx2-3 C A 19: 43,612,643 T48K probably benign Het
Nlrp4f T C 13: 65,194,989 T281A probably benign Het
Nmur1 A G 1: 86,387,741 V157A probably damaging Het
Obscn A T 11: 59,021,954 F6992L probably damaging Het
Ocm G T 5: 144,024,557 P22Q possibly damaging Het
Olfr1105 T C 2: 87,033,895 T109A probably damaging Het
Osbp2 C A 11: 3,711,793 C753F probably damaging Het
Pabpc2 A G 18: 39,774,503 T274A probably benign Het
Pamr1 T A 2: 102,642,336 I660N probably damaging Het
Papola C T 12: 105,820,448 T466I possibly damaging Het
Pask T C 1: 93,322,196 E494G possibly damaging Het
Pck1 A T 2: 173,155,221 I219F probably damaging Het
Pgm3 T C 9: 86,570,395 E4G probably benign Het
Pgs1 A G 11: 118,005,883 H462R probably damaging Het
Phlpp2 T A 8: 109,940,820 M1327K probably benign Het
Pkhd1 C A 1: 20,081,228 G3815W probably damaging Het
Plin4 T A 17: 56,106,981 I215F possibly damaging Het
Plod1 T G 4: 147,916,244 probably benign Het
Ppfia2 T C 10: 106,858,285 S707P probably damaging Het
Psmd12 A G 11: 107,486,433 Q86R probably benign Het
Rasgrf2 C A 13: 91,990,830 probably null Het
Rictor T C 15: 6,783,160 S926P possibly damaging Het
Rras2 A T 7: 114,050,349 I160N probably benign Het
Slc27a6 A T 18: 58,605,066 Y398F probably benign Het
Speer4f1 A G 5: 17,480,424 E239G unknown Het
Sppl2c T C 11: 104,188,315 I647T probably benign Het
Sptan1 A G 2: 30,031,062 Y2467C probably damaging Het
Sptbn1 G T 11: 30,154,297 H136N probably damaging Het
Stau2 T C 1: 16,346,045 probably null Het
Tet1 T A 10: 62,813,812 I40F probably damaging Het
Tnfaip2 A G 12: 111,446,029 E288G possibly damaging Het
Trav7-5 T A 14: 53,531,153 H59Q probably benign Het
Usp53 T C 3: 122,933,982 I984V probably benign Het
Wdfy4 A G 14: 33,145,316 I403T probably benign Het
Yars2 T A 16: 16,309,340 M423K probably benign Het
Zfp292 A T 4: 34,819,521 V272D possibly damaging Het
Zmynd11 A T 13: 9,689,567 V478D possibly damaging Het
Other mutations in Dnajb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02473:Dnajb3 APN 1 88205382 missense probably benign 0.00
IGL02489:Dnajb3 APN 1 88205310 missense probably benign 0.37
IGL02726:Dnajb3 APN 1 88205650 missense probably damaging 1.00
IGL02733:Dnajb3 APN 1 88204940 intron probably benign
IGL02867:Dnajb3 APN 1 88205527 missense probably benign 0.43
R1235:Dnajb3 UTSW 1 88205479 missense probably benign 0.03
R3154:Dnajb3 UTSW 1 88205051 missense probably benign 0.22
R4232:Dnajb3 UTSW 1 88205252 missense possibly damaging 0.75
R5033:Dnajb3 UTSW 1 88205023 missense possibly damaging 0.94
R6393:Dnajb3 UTSW 1 88205662 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- ACCGACTTGTAGTTGCCTG -3'
(R):5'- TACGAGGTCTTATCGGACGTCC -3'

Sequencing Primer
(F):5'- AGAAAGGCCCGAGTTTCCTG -3'
(R):5'- GATGCCTTCCAGTACGT -3'
Posted On2015-10-21