Incidental Mutation 'R4718:Ndst3'
ID354195
Institutional Source Beutler Lab
Gene Symbol Ndst3
Ensembl Gene ENSMUSG00000027977
Gene NameN-deacetylase/N-sulfotransferase (heparan glucosaminyl) 3
Synonyms4930511P15Rik, 4921531K01Rik
MMRRC Submission 041985-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.305) question?
Stock #R4718 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location123526166-123690853 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 123672266 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 19 (A19V)
Ref Sequence ENSEMBL: ENSMUSP00000118796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029602] [ENSMUST00000137404] [ENSMUST00000154668] [ENSMUST00000172537]
Predicted Effect probably benign
Transcript: ENSMUST00000029602
AA Change: A19V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000029602
Gene: ENSMUSG00000027977
AA Change: A19V

DomainStartEndE-ValueType
Pfam:HSNSD 19 506 4.6e-272 PFAM
Pfam:Sulfotransfer_1 595 858 8.4e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137404
AA Change: A19V

PolyPhen 2 Score 0.349 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000118796
Gene: ENSMUSG00000027977
AA Change: A19V

DomainStartEndE-ValueType
Pfam:HSNSD 19 506 6.4e-272 PFAM
PDB:1NST|A 549 637 2e-38 PDB
SCOP:d1nsta_ 570 641 9e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154668
AA Change: A19V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000118207
Gene: ENSMUSG00000027977
AA Change: A19V

DomainStartEndE-ValueType
Pfam:HSNSD 20 506 1.7e-253 PFAM
Pfam:Sulfotransfer_1 595 858 8.4e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172537
AA Change: A19V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000133657
Gene: ENSMUSG00000027977
AA Change: A19V

DomainStartEndE-ValueType
Pfam:HSNSD 20 328 2.4e-130 PFAM
Pfam:HSNSD 326 425 8.2e-62 PFAM
PDB:1NST|A 468 556 7e-39 PDB
SCOP:d1nsta_ 489 560 5e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199046
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the heparan sulfate/heparin GlcNAc N-deacetylase/ N-sulfotransferase family. The encoded enzyme is a type II transmembrane protein that resides in the Golgi apparatus. This monomeric bifunctional enzyme catalyzes the N-deacetylation and N-sulfation of N-acetylglucosamine residues in heparan sulfate and heparin, which are the initial chemical modifications required for the biosynthesis of the functional oligosaccharide sequences that define the specific ligand binding activities of heparan sulfate and heparin. [provided by RefSeq, Nov 2008]
PHENOTYPE: Mice homozygous for a knockout allele exhibit decreased anxiety-related behavior, cholesterol levels and CD8+ T cells due to moderate heparan-sulfate undersulfation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930519G04Rik G A 5: 114,863,554 probably null Het
Acsm2 A T 7: 119,573,603 Y147F probably damaging Het
Alg12 A T 15: 88,806,053 Y413N probably damaging Het
Arntl A T 7: 113,303,361 I399F probably damaging Het
Arrdc3 A T 13: 80,883,867 Q73L possibly damaging Het
Atp13a5 T C 16: 29,248,170 K1017E probably damaging Het
Bms1 T C 6: 118,403,235 N704D possibly damaging Het
Bsph1 T A 7: 13,472,182 Y47* probably null Het
Crat A T 2: 30,408,164 Y174* probably null Het
Csmd3 G T 15: 47,698,150 Y2254* probably null Het
Cyld T A 8: 88,742,305 I568N probably damaging Het
Dapl1 T C 2: 59,484,728 V7A probably benign Het
Dhx29 G A 13: 112,946,935 R508H unknown Het
Dnah9 A G 11: 66,085,473 I1250T probably benign Het
Dnajb3 C T 1: 88,205,339 D114N probably benign Het
Dsg1b A G 18: 20,397,929 N446D probably damaging Het
Dthd1 T A 5: 62,818,793 V270E probably damaging Het
F2rl3 A C 8: 72,762,908 R254S possibly damaging Het
Fam208b A T 13: 3,574,495 D1818E probably benign Het
Fgfr2 A G 7: 130,261,788 S24P probably damaging Het
Fpr2 T C 17: 17,893,336 V198A probably benign Het
Gbp2b G A 3: 142,598,995 G64D probably damaging Het
Gbp9 T G 5: 105,083,758 N321H probably damaging Het
Gk2 T A 5: 97,455,866 Y371F probably benign Het
Gm10382 T C 5: 125,389,398 probably benign Het
Gpatch3 A G 4: 133,582,544 D396G probably benign Het
Heatr5a A C 12: 51,916,163 L985V possibly damaging Het
Homer1 T A 13: 93,391,764 V269E probably damaging Het
Hspbap1 T C 16: 35,787,322 V66A probably benign Het
Ighv7-2 A C 12: 113,912,469 I5M possibly damaging Het
Ints7 T A 1: 191,583,277 F108Y possibly damaging Het
Itga7 CT CTGGGGATT 10: 128,940,734 probably null Het
Junb G A 8: 84,978,432 probably benign Het
Lcp2 A G 11: 34,070,992 N116S probably benign Het
Lrguk A G 6: 34,029,496 T14A probably benign Het
Lrrcc1 T A 3: 14,536,032 H41Q probably damaging Het
Ltb C A 17: 35,195,337 probably null Het
Mapk7 A G 11: 61,489,254 S693P possibly damaging Het
Mbd5 A T 2: 49,256,402 H208L possibly damaging Het
Megf9 A T 4: 70,448,778 S322R possibly damaging Het
Mgat4c T C 10: 102,388,606 V227A probably damaging Het
Mospd3 G A 5: 137,599,653 T151M probably benign Het
Mpl A G 4: 118,456,724 S115P probably benign Het
Myo6 C A 9: 80,246,517 D258E probably benign Het
N4bp2 G A 5: 65,803,463 M492I probably damaging Het
Nkx2-3 C A 19: 43,612,643 T48K probably benign Het
Nlrp4f T C 13: 65,194,989 T281A probably benign Het
Nmur1 A G 1: 86,387,741 V157A probably damaging Het
Obscn A T 11: 59,021,954 F6992L probably damaging Het
Ocm G T 5: 144,024,557 P22Q possibly damaging Het
Olfr1105 T C 2: 87,033,895 T109A probably damaging Het
Osbp2 C A 11: 3,711,793 C753F probably damaging Het
Pabpc2 A G 18: 39,774,503 T274A probably benign Het
Pamr1 T A 2: 102,642,336 I660N probably damaging Het
Papola C T 12: 105,820,448 T466I possibly damaging Het
Pask T C 1: 93,322,196 E494G possibly damaging Het
Pck1 A T 2: 173,155,221 I219F probably damaging Het
Pgm3 T C 9: 86,570,395 E4G probably benign Het
Pgs1 A G 11: 118,005,883 H462R probably damaging Het
Phlpp2 T A 8: 109,940,820 M1327K probably benign Het
Pkhd1 C A 1: 20,081,228 G3815W probably damaging Het
Plin4 T A 17: 56,106,981 I215F possibly damaging Het
Plod1 T G 4: 147,916,244 probably benign Het
Ppfia2 T C 10: 106,858,285 S707P probably damaging Het
Psmd12 A G 11: 107,486,433 Q86R probably benign Het
Rasgrf2 C A 13: 91,990,830 probably null Het
Rictor T C 15: 6,783,160 S926P possibly damaging Het
Rras2 A T 7: 114,050,349 I160N probably benign Het
Slc27a6 A T 18: 58,605,066 Y398F probably benign Het
Speer4f1 A G 5: 17,480,424 E239G unknown Het
Sppl2c T C 11: 104,188,315 I647T probably benign Het
Sptan1 A G 2: 30,031,062 Y2467C probably damaging Het
Sptbn1 G T 11: 30,154,297 H136N probably damaging Het
Stau2 T C 1: 16,346,045 probably null Het
Tet1 T A 10: 62,813,812 I40F probably damaging Het
Tnfaip2 A G 12: 111,446,029 E288G possibly damaging Het
Trav7-5 T A 14: 53,531,153 H59Q probably benign Het
Usp53 T C 3: 122,933,982 I984V probably benign Het
Wdfy4 A G 14: 33,145,316 I403T probably benign Het
Yars2 T A 16: 16,309,340 M423K probably benign Het
Zfp292 A T 4: 34,819,521 V272D possibly damaging Het
Zmynd11 A T 13: 9,689,567 V478D possibly damaging Het
Other mutations in Ndst3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00505:Ndst3 APN 3 123627950 splice site probably benign
IGL00543:Ndst3 APN 3 123672263 missense probably damaging 0.99
IGL01067:Ndst3 APN 3 123546817 missense probably damaging 1.00
IGL01301:Ndst3 APN 3 123548916 missense probably damaging 0.97
IGL01975:Ndst3 APN 3 123601514 missense possibly damaging 0.67
IGL02376:Ndst3 APN 3 123556798 missense probably damaging 0.98
IGL02715:Ndst3 APN 3 123546761 splice site probably benign
IGL03111:Ndst3 APN 3 123672096 missense possibly damaging 0.96
Jack_sprat UTSW 3 123552552 missense probably damaging 0.99
ANU18:Ndst3 UTSW 3 123548916 missense probably damaging 0.97
R0027:Ndst3 UTSW 3 123671513 missense probably damaging 1.00
R0288:Ndst3 UTSW 3 123672194 missense probably benign 0.03
R0630:Ndst3 UTSW 3 123562071 missense probably damaging 0.98
R1168:Ndst3 UTSW 3 123606968 missense probably benign 0.22
R1400:Ndst3 UTSW 3 123556828 missense probably damaging 1.00
R1513:Ndst3 UTSW 3 123601455 missense possibly damaging 0.75
R1524:Ndst3 UTSW 3 123548906 missense possibly damaging 0.94
R1830:Ndst3 UTSW 3 123548938 missense probably damaging 0.96
R1831:Ndst3 UTSW 3 123601478 missense probably benign
R1865:Ndst3 UTSW 3 123671471 missense probably damaging 1.00
R1871:Ndst3 UTSW 3 123562024 missense probably damaging 1.00
R2041:Ndst3 UTSW 3 123672215 missense probably benign 0.01
R2056:Ndst3 UTSW 3 123671885 missense probably damaging 0.98
R2362:Ndst3 UTSW 3 123552678 missense possibly damaging 0.94
R2484:Ndst3 UTSW 3 123552537 missense possibly damaging 0.83
R3747:Ndst3 UTSW 3 123671552 missense probably benign 0.09
R4152:Ndst3 UTSW 3 123672227 missense probably damaging 1.00
R4153:Ndst3 UTSW 3 123672227 missense probably damaging 1.00
R4154:Ndst3 UTSW 3 123672227 missense probably damaging 1.00
R4512:Ndst3 UTSW 3 123671666 missense probably damaging 1.00
R4579:Ndst3 UTSW 3 123546825 missense probably benign 0.00
R4611:Ndst3 UTSW 3 123671549 missense probably benign 0.35
R4646:Ndst3 UTSW 3 123672035 missense probably damaging 0.96
R4944:Ndst3 UTSW 3 123607027 missense probably damaging 0.99
R4945:Ndst3 UTSW 3 123552552 missense probably damaging 1.00
R5179:Ndst3 UTSW 3 123552532 missense probably damaging 0.97
R5232:Ndst3 UTSW 3 123672239 missense probably damaging 0.99
R5421:Ndst3 UTSW 3 123634359 intron probably null
R5874:Ndst3 UTSW 3 123561907 missense probably damaging 1.00
R6030:Ndst3 UTSW 3 123552519 missense probably damaging 1.00
R6030:Ndst3 UTSW 3 123552519 missense probably damaging 1.00
R6228:Ndst3 UTSW 3 123671652 nonsense probably null
R6496:Ndst3 UTSW 3 123552552 missense probably damaging 0.99
R6562:Ndst3 UTSW 3 123552532 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ACCAAGGGATGAGTACTGGC -3'
(R):5'- CAGATATGCTGCAATGGTGAC -3'

Sequencing Primer
(F):5'- AAGGGATGAGTACTGGCTCTCC -3'
(R):5'- TGGTGACATAAACTGTTGACTGAGAC -3'
Posted On2015-10-21