Incidental Mutation 'R4718:Zfp292'
ID354197
Institutional Source Beutler Lab
Gene Symbol Zfp292
Ensembl Gene ENSMUSG00000039967
Gene Namezinc finger protein 292
SynonymsZn-16, 5730450D02Rik, Zfp15, Zn-15, Zfp-15, 9430062L07Rik, Krox-10
MMRRC Submission 041985-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.648) question?
Stock #R4718 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location34803113-34882960 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 34819521 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 272 (V272D)
Ref Sequence ENSEMBL: ENSMUSP00000037233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047950] [ENSMUST00000098163]
Predicted Effect possibly damaging
Transcript: ENSMUST00000047950
AA Change: V272D

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000037233
Gene: ENSMUSG00000039967
AA Change: V272D

DomainStartEndE-ValueType
low complexity region 19 39 N/A INTRINSIC
low complexity region 101 120 N/A INTRINSIC
low complexity region 512 523 N/A INTRINSIC
ZnF_C2H2 540 561 5.12e1 SMART
ZnF_C2H2 567 589 4.72e-2 SMART
low complexity region 649 664 N/A INTRINSIC
ZnF_C2H2 681 705 3.52e-1 SMART
ZnF_C2H2 722 744 1.53e-1 SMART
ZnF_C2H2 750 774 1.62e0 SMART
ZnF_C2H2 779 803 1.08e1 SMART
ZnF_C2H2 807 831 1.95e-3 SMART
low complexity region 1062 1078 N/A INTRINSIC
ZnF_C2H2 1085 1110 7.67e-2 SMART
ZnF_C2H2 1361 1381 1.93e2 SMART
low complexity region 1606 1618 N/A INTRINSIC
ZnF_C2H2 1879 1904 4.4e-2 SMART
ZnF_C2H2 1924 1949 5.42e-2 SMART
low complexity region 2004 2014 N/A INTRINSIC
low complexity region 2024 2037 N/A INTRINSIC
coiled coil region 2050 2072 N/A INTRINSIC
ZnF_C2H2 2091 2116 4.45e0 SMART
low complexity region 2121 2143 N/A INTRINSIC
ZnF_C2H2 2149 2174 1.64e-1 SMART
ZnF_C2H2 2193 2218 3.24e0 SMART
ZnF_C2H2 2233 2258 1.18e-2 SMART
low complexity region 2301 2314 N/A INTRINSIC
ZnF_C2H2 2362 2386 2.86e-1 SMART
low complexity region 2589 2605 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000098163
AA Change: V267D

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000095766
Gene: ENSMUSG00000039967
AA Change: V267D

DomainStartEndE-ValueType
low complexity region 19 39 N/A INTRINSIC
low complexity region 101 120 N/A INTRINSIC
low complexity region 507 518 N/A INTRINSIC
ZnF_C2H2 535 556 5.12e1 SMART
ZnF_C2H2 562 584 4.72e-2 SMART
low complexity region 644 659 N/A INTRINSIC
ZnF_C2H2 676 700 3.52e-1 SMART
ZnF_C2H2 717 739 1.53e-1 SMART
ZnF_C2H2 745 769 1.62e0 SMART
ZnF_C2H2 774 798 1.08e1 SMART
ZnF_C2H2 802 826 1.95e-3 SMART
low complexity region 1057 1073 N/A INTRINSIC
ZnF_C2H2 1080 1105 7.67e-2 SMART
ZnF_C2H2 1356 1376 1.93e2 SMART
low complexity region 1601 1613 N/A INTRINSIC
ZnF_C2H2 1874 1899 4.4e-2 SMART
ZnF_C2H2 1919 1944 5.42e-2 SMART
low complexity region 1999 2009 N/A INTRINSIC
low complexity region 2019 2032 N/A INTRINSIC
coiled coil region 2045 2067 N/A INTRINSIC
ZnF_C2H2 2086 2111 4.45e0 SMART
low complexity region 2116 2138 N/A INTRINSIC
ZnF_C2H2 2144 2169 1.64e-1 SMART
ZnF_C2H2 2188 2213 3.24e0 SMART
ZnF_C2H2 2228 2253 1.18e-2 SMART
low complexity region 2296 2309 N/A INTRINSIC
ZnF_C2H2 2357 2381 2.86e-1 SMART
low complexity region 2584 2600 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930519G04Rik G A 5: 114,863,554 probably null Het
Acsm2 A T 7: 119,573,603 Y147F probably damaging Het
Alg12 A T 15: 88,806,053 Y413N probably damaging Het
Arntl A T 7: 113,303,361 I399F probably damaging Het
Arrdc3 A T 13: 80,883,867 Q73L possibly damaging Het
Atp13a5 T C 16: 29,248,170 K1017E probably damaging Het
Bms1 T C 6: 118,403,235 N704D possibly damaging Het
Bsph1 T A 7: 13,472,182 Y47* probably null Het
Crat A T 2: 30,408,164 Y174* probably null Het
Csmd3 G T 15: 47,698,150 Y2254* probably null Het
Cyld T A 8: 88,742,305 I568N probably damaging Het
Dapl1 T C 2: 59,484,728 V7A probably benign Het
Dhx29 G A 13: 112,946,935 R508H unknown Het
Dnah9 A G 11: 66,085,473 I1250T probably benign Het
Dnajb3 C T 1: 88,205,339 D114N probably benign Het
Dsg1b A G 18: 20,397,929 N446D probably damaging Het
Dthd1 T A 5: 62,818,793 V270E probably damaging Het
F2rl3 A C 8: 72,762,908 R254S possibly damaging Het
Fam208b A T 13: 3,574,495 D1818E probably benign Het
Fgfr2 A G 7: 130,261,788 S24P probably damaging Het
Fpr2 T C 17: 17,893,336 V198A probably benign Het
Gbp2b G A 3: 142,598,995 G64D probably damaging Het
Gbp9 T G 5: 105,083,758 N321H probably damaging Het
Gk2 T A 5: 97,455,866 Y371F probably benign Het
Gm10382 T C 5: 125,389,398 probably benign Het
Gpatch3 A G 4: 133,582,544 D396G probably benign Het
Heatr5a A C 12: 51,916,163 L985V possibly damaging Het
Homer1 T A 13: 93,391,764 V269E probably damaging Het
Hspbap1 T C 16: 35,787,322 V66A probably benign Het
Ighv7-2 A C 12: 113,912,469 I5M possibly damaging Het
Ints7 T A 1: 191,583,277 F108Y possibly damaging Het
Itga7 CT CTGGGGATT 10: 128,940,734 probably null Het
Junb G A 8: 84,978,432 probably benign Het
Lcp2 A G 11: 34,070,992 N116S probably benign Het
Lrguk A G 6: 34,029,496 T14A probably benign Het
Lrrcc1 T A 3: 14,536,032 H41Q probably damaging Het
Ltb C A 17: 35,195,337 probably null Het
Mapk7 A G 11: 61,489,254 S693P possibly damaging Het
Mbd5 A T 2: 49,256,402 H208L possibly damaging Het
Megf9 A T 4: 70,448,778 S322R possibly damaging Het
Mgat4c T C 10: 102,388,606 V227A probably damaging Het
Mospd3 G A 5: 137,599,653 T151M probably benign Het
Mpl A G 4: 118,456,724 S115P probably benign Het
Myo6 C A 9: 80,246,517 D258E probably benign Het
N4bp2 G A 5: 65,803,463 M492I probably damaging Het
Ndst3 G A 3: 123,672,266 A19V probably benign Het
Nkx2-3 C A 19: 43,612,643 T48K probably benign Het
Nlrp4f T C 13: 65,194,989 T281A probably benign Het
Nmur1 A G 1: 86,387,741 V157A probably damaging Het
Obscn A T 11: 59,021,954 F6992L probably damaging Het
Ocm G T 5: 144,024,557 P22Q possibly damaging Het
Olfr1105 T C 2: 87,033,895 T109A probably damaging Het
Osbp2 C A 11: 3,711,793 C753F probably damaging Het
Pabpc2 A G 18: 39,774,503 T274A probably benign Het
Pamr1 T A 2: 102,642,336 I660N probably damaging Het
Papola C T 12: 105,820,448 T466I possibly damaging Het
Pask T C 1: 93,322,196 E494G possibly damaging Het
Pck1 A T 2: 173,155,221 I219F probably damaging Het
Pgm3 T C 9: 86,570,395 E4G probably benign Het
Pgs1 A G 11: 118,005,883 H462R probably damaging Het
Phlpp2 T A 8: 109,940,820 M1327K probably benign Het
Pkhd1 C A 1: 20,081,228 G3815W probably damaging Het
Plin4 T A 17: 56,106,981 I215F possibly damaging Het
Plod1 T G 4: 147,916,244 probably benign Het
Ppfia2 T C 10: 106,858,285 S707P probably damaging Het
Psmd12 A G 11: 107,486,433 Q86R probably benign Het
Rasgrf2 C A 13: 91,990,830 probably null Het
Rictor T C 15: 6,783,160 S926P possibly damaging Het
Rras2 A T 7: 114,050,349 I160N probably benign Het
Slc27a6 A T 18: 58,605,066 Y398F probably benign Het
Speer4f1 A G 5: 17,480,424 E239G unknown Het
Sppl2c T C 11: 104,188,315 I647T probably benign Het
Sptan1 A G 2: 30,031,062 Y2467C probably damaging Het
Sptbn1 G T 11: 30,154,297 H136N probably damaging Het
Stau2 T C 1: 16,346,045 probably null Het
Tet1 T A 10: 62,813,812 I40F probably damaging Het
Tnfaip2 A G 12: 111,446,029 E288G possibly damaging Het
Trav7-5 T A 14: 53,531,153 H59Q probably benign Het
Usp53 T C 3: 122,933,982 I984V probably benign Het
Wdfy4 A G 14: 33,145,316 I403T probably benign Het
Yars2 T A 16: 16,309,340 M423K probably benign Het
Zmynd11 A T 13: 9,689,567 V478D possibly damaging Het
Other mutations in Zfp292
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Zfp292 APN 4 34808683 missense probably benign 0.15
IGL00502:Zfp292 APN 4 34809775 missense possibly damaging 0.63
IGL00539:Zfp292 APN 4 34808790 missense probably damaging 0.98
IGL00676:Zfp292 APN 4 34807827 missense probably damaging 0.99
IGL01068:Zfp292 APN 4 34806763 missense probably damaging 1.00
IGL01311:Zfp292 APN 4 34807961 missense probably benign 0.01
IGL01639:Zfp292 APN 4 34809048 missense probably benign 0.04
IGL01688:Zfp292 APN 4 34807855 missense possibly damaging 0.93
IGL02345:Zfp292 APN 4 34809244 missense possibly damaging 0.94
IGL02444:Zfp292 APN 4 34808810 missense possibly damaging 0.87
IGL02548:Zfp292 APN 4 34805416 missense probably damaging 1.00
IGL02551:Zfp292 APN 4 34806462 missense possibly damaging 0.93
IGL02702:Zfp292 APN 4 34809415 missense probably benign 0.14
IGL02715:Zfp292 APN 4 34819542 missense probably damaging 1.00
IGL03273:Zfp292 APN 4 34806163 missense probably benign 0.00
F5770:Zfp292 UTSW 4 34806783 missense possibly damaging 0.85
R0153:Zfp292 UTSW 4 34811185 missense probably benign 0.26
R0184:Zfp292 UTSW 4 34819563 missense probably damaging 1.00
R0295:Zfp292 UTSW 4 34806281 missense probably damaging 1.00
R0367:Zfp292 UTSW 4 34808227 missense probably benign 0.25
R0433:Zfp292 UTSW 4 34839959 missense probably damaging 0.99
R0481:Zfp292 UTSW 4 34810059 missense probably benign 0.28
R0555:Zfp292 UTSW 4 34807194 missense probably damaging 1.00
R0597:Zfp292 UTSW 4 34807399 missense probably benign 0.02
R0748:Zfp292 UTSW 4 34816424 splice site probably benign
R0782:Zfp292 UTSW 4 34839382 missense possibly damaging 0.94
R0834:Zfp292 UTSW 4 34809114 missense probably benign 0.00
R0879:Zfp292 UTSW 4 34811218 missense probably benign 0.00
R1083:Zfp292 UTSW 4 34807569 missense probably damaging 0.98
R1343:Zfp292 UTSW 4 34805238 missense probably damaging 0.98
R1498:Zfp292 UTSW 4 34805397 missense possibly damaging 0.88
R1714:Zfp292 UTSW 4 34808935 missense probably damaging 1.00
R1724:Zfp292 UTSW 4 34811237 missense probably damaging 1.00
R1755:Zfp292 UTSW 4 34811043 missense probably benign 0.02
R1837:Zfp292 UTSW 4 34810264 missense probably damaging 0.98
R1914:Zfp292 UTSW 4 34805100 missense possibly damaging 0.92
R1915:Zfp292 UTSW 4 34805100 missense possibly damaging 0.92
R1936:Zfp292 UTSW 4 34807452 missense probably benign 0.22
R2107:Zfp292 UTSW 4 34808593 missense possibly damaging 0.86
R2108:Zfp292 UTSW 4 34808593 missense possibly damaging 0.86
R2136:Zfp292 UTSW 4 34810266 missense probably benign 0.13
R2182:Zfp292 UTSW 4 34807417 missense probably damaging 1.00
R2186:Zfp292 UTSW 4 34807962 missense probably benign 0.07
R2306:Zfp292 UTSW 4 34809468 missense probably damaging 0.96
R2350:Zfp292 UTSW 4 34811281 missense probably damaging 1.00
R2382:Zfp292 UTSW 4 34806426 missense possibly damaging 0.91
R2872:Zfp292 UTSW 4 34808595 missense probably damaging 1.00
R2872:Zfp292 UTSW 4 34808595 missense probably damaging 1.00
R3018:Zfp292 UTSW 4 34808814 missense probably damaging 0.99
R3812:Zfp292 UTSW 4 34810326 missense probably damaging 0.98
R4006:Zfp292 UTSW 4 34807744 missense probably benign 0.00
R4006:Zfp292 UTSW 4 34809611 missense possibly damaging 0.62
R4060:Zfp292 UTSW 4 34810863 missense probably damaging 1.00
R4062:Zfp292 UTSW 4 34810863 missense probably damaging 1.00
R4063:Zfp292 UTSW 4 34810863 missense probably damaging 1.00
R4064:Zfp292 UTSW 4 34810863 missense probably damaging 1.00
R4207:Zfp292 UTSW 4 34806079 missense probably benign 0.04
R4641:Zfp292 UTSW 4 34807828 missense probably damaging 0.99
R4684:Zfp292 UTSW 4 34807078 missense probably benign 0.00
R4865:Zfp292 UTSW 4 34819563 missense probably damaging 1.00
R4870:Zfp292 UTSW 4 34808917 missense probably damaging 1.00
R5097:Zfp292 UTSW 4 34839878 missense possibly damaging 0.89
R5233:Zfp292 UTSW 4 34809755 missense probably damaging 1.00
R5246:Zfp292 UTSW 4 34805842 missense possibly damaging 0.76
R5369:Zfp292 UTSW 4 34807491 missense possibly damaging 0.89
R5527:Zfp292 UTSW 4 34806261 missense probably damaging 1.00
R5621:Zfp292 UTSW 4 34811703 missense probably damaging 0.98
R5770:Zfp292 UTSW 4 34806747 missense probably damaging 1.00
R5900:Zfp292 UTSW 4 34805125 missense probably damaging 1.00
R5905:Zfp292 UTSW 4 34819549 missense probably damaging 1.00
R5994:Zfp292 UTSW 4 34805464 missense possibly damaging 0.87
R6028:Zfp292 UTSW 4 34819549 missense probably damaging 1.00
R6056:Zfp292 UTSW 4 34809784 missense probably damaging 1.00
R6093:Zfp292 UTSW 4 34811902 missense probably damaging 1.00
R6126:Zfp292 UTSW 4 34808497 missense probably benign 0.13
R6209:Zfp292 UTSW 4 34809442 missense probably benign 0.14
R6275:Zfp292 UTSW 4 34808883 missense possibly damaging 0.93
R6523:Zfp292 UTSW 4 34816301 missense probably benign 0.21
R6747:Zfp292 UTSW 4 34806894 missense probably damaging 0.97
R6752:Zfp292 UTSW 4 34808593 missense possibly damaging 0.86
R6967:Zfp292 UTSW 4 34807812 missense probably damaging 1.00
V7580:Zfp292 UTSW 4 34806783 missense possibly damaging 0.85
V7581:Zfp292 UTSW 4 34806783 missense possibly damaging 0.85
V7582:Zfp292 UTSW 4 34806783 missense possibly damaging 0.85
V7583:Zfp292 UTSW 4 34806783 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- GCGTGCACATATCTCCAGAG -3'
(R):5'- ATAACTTGCCAAGTCTTTATCTCAG -3'

Sequencing Primer
(F):5'- ACTGCAGGAGGCCATCTTGATTAC -3'
(R):5'- TTGCCAAGTCTTTATCTCAGTTATC -3'
Posted On2015-10-21