Incidental Mutation 'R4718:Gbp9'
ID354207
Institutional Source Beutler Lab
Gene Symbol Gbp9
Ensembl Gene ENSMUSG00000029298
Gene Nameguanylate-binding protein 9
Synonyms
MMRRC Submission 041985-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock #R4718 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location105077630-105139539 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 105083758 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Histidine at position 321 (N321H)
Ref Sequence ENSEMBL: ENSMUSP00000098521 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031235] [ENSMUST00000031238] [ENSMUST00000100961]
Predicted Effect probably benign
Transcript: ENSMUST00000031235
SMART Domains Protein: ENSMUSP00000031235
Gene: ENSMUSG00000034438

DomainStartEndE-ValueType
Pfam:GBP 16 213 5.4e-91 PFAM
Pfam:GBP_C 206 493 1e-115 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000031238
AA Change: N321H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031238
Gene: ENSMUSG00000029298
AA Change: N321H

DomainStartEndE-ValueType
Pfam:GBP 16 279 1.2e-117 PFAM
Pfam:GBP_C 281 575 4.5e-115 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000100961
AA Change: N321H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098521
Gene: ENSMUSG00000029298
AA Change: N321H

DomainStartEndE-ValueType
Pfam:GBP 16 279 3.8e-124 PFAM
Pfam:GBP_C 281 575 4.5e-115 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196820
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199453
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930519G04Rik G A 5: 114,863,554 probably null Het
Acsm2 A T 7: 119,573,603 Y147F probably damaging Het
Alg12 A T 15: 88,806,053 Y413N probably damaging Het
Arntl A T 7: 113,303,361 I399F probably damaging Het
Arrdc3 A T 13: 80,883,867 Q73L possibly damaging Het
Atp13a5 T C 16: 29,248,170 K1017E probably damaging Het
Bms1 T C 6: 118,403,235 N704D possibly damaging Het
Bsph1 T A 7: 13,472,182 Y47* probably null Het
Crat A T 2: 30,408,164 Y174* probably null Het
Csmd3 G T 15: 47,698,150 Y2254* probably null Het
Cyld T A 8: 88,742,305 I568N probably damaging Het
Dapl1 T C 2: 59,484,728 V7A probably benign Het
Dhx29 G A 13: 112,946,935 R508H unknown Het
Dnah9 A G 11: 66,085,473 I1250T probably benign Het
Dnajb3 C T 1: 88,205,339 D114N probably benign Het
Dsg1b A G 18: 20,397,929 N446D probably damaging Het
Dthd1 T A 5: 62,818,793 V270E probably damaging Het
F2rl3 A C 8: 72,762,908 R254S possibly damaging Het
Fam208b A T 13: 3,574,495 D1818E probably benign Het
Fgfr2 A G 7: 130,261,788 S24P probably damaging Het
Fpr2 T C 17: 17,893,336 V198A probably benign Het
Gbp2b G A 3: 142,598,995 G64D probably damaging Het
Gk2 T A 5: 97,455,866 Y371F probably benign Het
Gm10382 T C 5: 125,389,398 probably benign Het
Gpatch3 A G 4: 133,582,544 D396G probably benign Het
Heatr5a A C 12: 51,916,163 L985V possibly damaging Het
Homer1 T A 13: 93,391,764 V269E probably damaging Het
Hspbap1 T C 16: 35,787,322 V66A probably benign Het
Ighv7-2 A C 12: 113,912,469 I5M possibly damaging Het
Ints7 T A 1: 191,583,277 F108Y possibly damaging Het
Itga7 CT CTGGGGATT 10: 128,940,734 probably null Het
Junb G A 8: 84,978,432 probably benign Het
Lcp2 A G 11: 34,070,992 N116S probably benign Het
Lrguk A G 6: 34,029,496 T14A probably benign Het
Lrrcc1 T A 3: 14,536,032 H41Q probably damaging Het
Ltb C A 17: 35,195,337 probably null Het
Mapk7 A G 11: 61,489,254 S693P possibly damaging Het
Mbd5 A T 2: 49,256,402 H208L possibly damaging Het
Megf9 A T 4: 70,448,778 S322R possibly damaging Het
Mgat4c T C 10: 102,388,606 V227A probably damaging Het
Mospd3 G A 5: 137,599,653 T151M probably benign Het
Mpl A G 4: 118,456,724 S115P probably benign Het
Myo6 C A 9: 80,246,517 D258E probably benign Het
N4bp2 G A 5: 65,803,463 M492I probably damaging Het
Ndst3 G A 3: 123,672,266 A19V probably benign Het
Nkx2-3 C A 19: 43,612,643 T48K probably benign Het
Nlrp4f T C 13: 65,194,989 T281A probably benign Het
Nmur1 A G 1: 86,387,741 V157A probably damaging Het
Obscn A T 11: 59,021,954 F6992L probably damaging Het
Ocm G T 5: 144,024,557 P22Q possibly damaging Het
Olfr1105 T C 2: 87,033,895 T109A probably damaging Het
Osbp2 C A 11: 3,711,793 C753F probably damaging Het
Pabpc2 A G 18: 39,774,503 T274A probably benign Het
Pamr1 T A 2: 102,642,336 I660N probably damaging Het
Papola C T 12: 105,820,448 T466I possibly damaging Het
Pask T C 1: 93,322,196 E494G possibly damaging Het
Pck1 A T 2: 173,155,221 I219F probably damaging Het
Pgm3 T C 9: 86,570,395 E4G probably benign Het
Pgs1 A G 11: 118,005,883 H462R probably damaging Het
Phlpp2 T A 8: 109,940,820 M1327K probably benign Het
Pkhd1 C A 1: 20,081,228 G3815W probably damaging Het
Plin4 T A 17: 56,106,981 I215F possibly damaging Het
Plod1 T G 4: 147,916,244 probably benign Het
Ppfia2 T C 10: 106,858,285 S707P probably damaging Het
Psmd12 A G 11: 107,486,433 Q86R probably benign Het
Rasgrf2 C A 13: 91,990,830 probably null Het
Rictor T C 15: 6,783,160 S926P possibly damaging Het
Rras2 A T 7: 114,050,349 I160N probably benign Het
Slc27a6 A T 18: 58,605,066 Y398F probably benign Het
Speer4f1 A G 5: 17,480,424 E239G unknown Het
Sppl2c T C 11: 104,188,315 I647T probably benign Het
Sptan1 A G 2: 30,031,062 Y2467C probably damaging Het
Sptbn1 G T 11: 30,154,297 H136N probably damaging Het
Stau2 T C 1: 16,346,045 probably null Het
Tet1 T A 10: 62,813,812 I40F probably damaging Het
Tnfaip2 A G 12: 111,446,029 E288G possibly damaging Het
Trav7-5 T A 14: 53,531,153 H59Q probably benign Het
Usp53 T C 3: 122,933,982 I984V probably benign Het
Wdfy4 A G 14: 33,145,316 I403T probably benign Het
Yars2 T A 16: 16,309,340 M423K probably benign Het
Zfp292 A T 4: 34,819,521 V272D possibly damaging Het
Zmynd11 A T 13: 9,689,567 V478D possibly damaging Het
Other mutations in Gbp9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Gbp9 APN 5 105081264 missense probably benign 0.01
IGL00419:Gbp9 APN 5 105094077 missense probably benign 0.05
IGL00425:Gbp9 APN 5 105105754 missense possibly damaging 0.82
IGL00597:Gbp9 APN 5 105094498 missense probably damaging 1.00
IGL01362:Gbp9 APN 5 105080206 missense probably damaging 1.00
IGL01679:Gbp9 APN 5 105085172 splice site probably null
IGL01803:Gbp9 APN 5 105094173 missense probably damaging 1.00
IGL01803:Gbp9 APN 5 105085018 missense probably damaging 0.99
IGL02054:Gbp9 APN 5 105082807 missense probably benign 0.12
IGL02474:Gbp9 APN 5 105094567 splice site probably benign
IGL02633:Gbp9 APN 5 105083565 splice site probably benign
IGL02666:Gbp9 APN 5 105094275 splice site probably null
IGL02689:Gbp9 APN 5 105105796 missense probably benign 0.11
IGL02812:Gbp9 APN 5 105083758 missense probably damaging 1.00
IGL03132:Gbp9 APN 5 105084953 missense possibly damaging 0.83
IGL03274:Gbp9 APN 5 105082786 missense possibly damaging 0.58
R0410:Gbp9 UTSW 5 105085073 missense probably benign 0.17
R1018:Gbp9 UTSW 5 105080260 missense probably benign 0.15
R1479:Gbp9 UTSW 5 105094064 splice site probably benign
R1655:Gbp9 UTSW 5 105081692 missense possibly damaging 0.76
R1658:Gbp9 UTSW 5 105094468 missense probably damaging 0.98
R1757:Gbp9 UTSW 5 105094453 missense probably damaging 1.00
R1950:Gbp9 UTSW 5 105081246 missense probably benign 0.01
R1986:Gbp9 UTSW 5 105105724 missense probably damaging 1.00
R1986:Gbp9 UTSW 5 105105786 missense probably damaging 0.98
R2124:Gbp9 UTSW 5 105094543 missense probably damaging 1.00
R2302:Gbp9 UTSW 5 105094092 missense possibly damaging 0.47
R2378:Gbp9 UTSW 5 105080176 missense probably benign 0.02
R2997:Gbp9 UTSW 5 105082769 missense probably benign 0.00
R3745:Gbp9 UTSW 5 105105858 start gained probably benign
R4182:Gbp9 UTSW 5 105083595 missense probably benign 0.08
R4485:Gbp9 UTSW 5 105083808 missense probably damaging 0.97
R5063:Gbp9 UTSW 5 105085162 missense probably benign
R5099:Gbp9 UTSW 5 105094513 missense probably damaging 1.00
R5104:Gbp9 UTSW 5 105080141 missense probably benign 0.00
R5199:Gbp9 UTSW 5 105083812 missense probably benign 0.04
R5712:Gbp9 UTSW 5 105094555 missense possibly damaging 0.80
R5751:Gbp9 UTSW 5 105081258 missense probably benign 0.06
R5895:Gbp9 UTSW 5 105082858 missense probably damaging 1.00
R6360:Gbp9 UTSW 5 105083730 missense probably benign 0.03
R6646:Gbp9 UTSW 5 105082903 missense probably benign 0.13
Z1088:Gbp9 UTSW 5 105094125 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCAGTTTCTTCAGGAATTGCTG -3'
(R):5'- ACTTGCTGAAGAAGATTGTTGG -3'

Sequencing Primer
(F):5'- CAGGAATTGCTGATTTTCATCCTTG -3'
(R):5'- GGATACATGTGTGTGTATGCATAC -3'
Posted On2015-10-21