Incidental Mutation 'R4718:Arntl'
ID354215
Institutional Source Beutler Lab
Gene Symbol Arntl
Ensembl Gene ENSMUSG00000055116
Gene Namearyl hydrocarbon receptor nuclear translocator-like
SynonymsBmal1, MOP3, bHLHe5, Arnt3
MMRRC Submission 041985-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.712) question?
Stock #R4718 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location113207465-113314126 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 113303361 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 399 (I399F)
Ref Sequence ENSEMBL: ENSMUSP00000147989 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047321] [ENSMUST00000210074] [ENSMUST00000210238] [ENSMUST00000211770]
Predicted Effect probably damaging
Transcript: ENSMUST00000047321
AA Change: I399F

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000046235
Gene: ENSMUSG00000055116
AA Change: I399F

DomainStartEndE-ValueType
HLH 78 131 2.92e-16 SMART
PAS 146 213 4.41e-12 SMART
PAS 328 394 1.66e-7 SMART
PAC 401 444 2.92e-3 SMART
low complexity region 511 521 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000210074
AA Change: I386F

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000210238
AA Change: I399F

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211547
Predicted Effect possibly damaging
Transcript: ENSMUST00000211770
AA Change: I406F

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a basic helix-loop-helix protein that forms a heterodimer with Clock. This heterodimer binds E-box enhancer elements upstream of Period (Per1, Per2, Per3) and Cryptochrome (Cry1, Cry2) genes and activates transcription of these genes. Per and Cry proteins heterodimerize and repress their own transcription by interacting in a feedback loop with Clock/Arntl complexes. Defects in this gene have been linked to infertility, problems with gluconeogenesis and lipogenesis, and altered sleep patterns. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygous mutation of this gene results in abnormal light/dark cycle activity and decreases overall activity levels. Mice homozygous for another knock-out allele exhibit loss of circadian rhythm in locomotor activity, dyslipidemia, ectopic fat formationand altered energy homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930519G04Rik G A 5: 114,863,554 probably null Het
Acsm2 A T 7: 119,573,603 Y147F probably damaging Het
Alg12 A T 15: 88,806,053 Y413N probably damaging Het
Arrdc3 A T 13: 80,883,867 Q73L possibly damaging Het
Atp13a5 T C 16: 29,248,170 K1017E probably damaging Het
Bms1 T C 6: 118,403,235 N704D possibly damaging Het
Bsph1 T A 7: 13,472,182 Y47* probably null Het
Crat A T 2: 30,408,164 Y174* probably null Het
Csmd3 G T 15: 47,698,150 Y2254* probably null Het
Cyld T A 8: 88,742,305 I568N probably damaging Het
Dapl1 T C 2: 59,484,728 V7A probably benign Het
Dhx29 G A 13: 112,946,935 R508H unknown Het
Dnah9 A G 11: 66,085,473 I1250T probably benign Het
Dnajb3 C T 1: 88,205,339 D114N probably benign Het
Dsg1b A G 18: 20,397,929 N446D probably damaging Het
Dthd1 T A 5: 62,818,793 V270E probably damaging Het
F2rl3 A C 8: 72,762,908 R254S possibly damaging Het
Fam208b A T 13: 3,574,495 D1818E probably benign Het
Fgfr2 A G 7: 130,261,788 S24P probably damaging Het
Fpr2 T C 17: 17,893,336 V198A probably benign Het
Gbp2b G A 3: 142,598,995 G64D probably damaging Het
Gbp9 T G 5: 105,083,758 N321H probably damaging Het
Gk2 T A 5: 97,455,866 Y371F probably benign Het
Gm10382 T C 5: 125,389,398 probably benign Het
Gpatch3 A G 4: 133,582,544 D396G probably benign Het
Heatr5a A C 12: 51,916,163 L985V possibly damaging Het
Homer1 T A 13: 93,391,764 V269E probably damaging Het
Hspbap1 T C 16: 35,787,322 V66A probably benign Het
Ighv7-2 A C 12: 113,912,469 I5M possibly damaging Het
Ints7 T A 1: 191,583,277 F108Y possibly damaging Het
Itga7 CT CTGGGGATT 10: 128,940,734 probably null Het
Junb G A 8: 84,978,432 probably benign Het
Lcp2 A G 11: 34,070,992 N116S probably benign Het
Lrguk A G 6: 34,029,496 T14A probably benign Het
Lrrcc1 T A 3: 14,536,032 H41Q probably damaging Het
Ltb C A 17: 35,195,337 probably null Het
Mapk7 A G 11: 61,489,254 S693P possibly damaging Het
Mbd5 A T 2: 49,256,402 H208L possibly damaging Het
Megf9 A T 4: 70,448,778 S322R possibly damaging Het
Mgat4c T C 10: 102,388,606 V227A probably damaging Het
Mospd3 G A 5: 137,599,653 T151M probably benign Het
Mpl A G 4: 118,456,724 S115P probably benign Het
Myo6 C A 9: 80,246,517 D258E probably benign Het
N4bp2 G A 5: 65,803,463 M492I probably damaging Het
Ndst3 G A 3: 123,672,266 A19V probably benign Het
Nkx2-3 C A 19: 43,612,643 T48K probably benign Het
Nlrp4f T C 13: 65,194,989 T281A probably benign Het
Nmur1 A G 1: 86,387,741 V157A probably damaging Het
Obscn A T 11: 59,021,954 F6992L probably damaging Het
Ocm G T 5: 144,024,557 P22Q possibly damaging Het
Olfr1105 T C 2: 87,033,895 T109A probably damaging Het
Osbp2 C A 11: 3,711,793 C753F probably damaging Het
Pabpc2 A G 18: 39,774,503 T274A probably benign Het
Pamr1 T A 2: 102,642,336 I660N probably damaging Het
Papola C T 12: 105,820,448 T466I possibly damaging Het
Pask T C 1: 93,322,196 E494G possibly damaging Het
Pck1 A T 2: 173,155,221 I219F probably damaging Het
Pgm3 T C 9: 86,570,395 E4G probably benign Het
Pgs1 A G 11: 118,005,883 H462R probably damaging Het
Phlpp2 T A 8: 109,940,820 M1327K probably benign Het
Pkhd1 C A 1: 20,081,228 G3815W probably damaging Het
Plin4 T A 17: 56,106,981 I215F possibly damaging Het
Plod1 T G 4: 147,916,244 probably benign Het
Ppfia2 T C 10: 106,858,285 S707P probably damaging Het
Psmd12 A G 11: 107,486,433 Q86R probably benign Het
Rasgrf2 C A 13: 91,990,830 probably null Het
Rictor T C 15: 6,783,160 S926P possibly damaging Het
Rras2 A T 7: 114,050,349 I160N probably benign Het
Slc27a6 A T 18: 58,605,066 Y398F probably benign Het
Speer4f1 A G 5: 17,480,424 E239G unknown Het
Sppl2c T C 11: 104,188,315 I647T probably benign Het
Sptan1 A G 2: 30,031,062 Y2467C probably damaging Het
Sptbn1 G T 11: 30,154,297 H136N probably damaging Het
Stau2 T C 1: 16,346,045 probably null Het
Tet1 T A 10: 62,813,812 I40F probably damaging Het
Tnfaip2 A G 12: 111,446,029 E288G possibly damaging Het
Trav7-5 T A 14: 53,531,153 H59Q probably benign Het
Usp53 T C 3: 122,933,982 I984V probably benign Het
Wdfy4 A G 14: 33,145,316 I403T probably benign Het
Yars2 T A 16: 16,309,340 M423K probably benign Het
Zfp292 A T 4: 34,819,521 V272D possibly damaging Het
Zmynd11 A T 13: 9,689,567 V478D possibly damaging Het
Other mutations in Arntl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01320:Arntl APN 7 113303407 missense probably damaging 0.99
diet UTSW 7 113285031 missense probably damaging 1.00
R0308:Arntl UTSW 7 113291536 missense probably damaging 1.00
R2039:Arntl UTSW 7 113285112 missense probably damaging 1.00
R3548:Arntl UTSW 7 113313545 missense probably damaging 1.00
R4355:Arntl UTSW 7 113303406 missense possibly damaging 0.46
R4725:Arntl UTSW 7 113304359 missense possibly damaging 0.82
R4776:Arntl UTSW 7 113285037 missense probably damaging 1.00
R4920:Arntl UTSW 7 113285114 missense probably damaging 1.00
R4960:Arntl UTSW 7 113299435 critical splice donor site probably null
R4985:Arntl UTSW 7 113285073 missense probably damaging 1.00
R5640:Arntl UTSW 7 113308681 missense probably damaging 1.00
R5739:Arntl UTSW 7 113285031 missense probably damaging 1.00
R6004:Arntl UTSW 7 113280727 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AAAGTGTGAGTTAGACCCTTGGG -3'
(R):5'- TGTCCCAGGTAAAGATCCCAAG -3'

Sequencing Primer
(F):5'- AGTTAGACCCTTGGGTGCCTC -3'
(R):5'- CCCCTGCCCCCATTTGAAG -3'
Posted On2015-10-21