Incidental Mutation 'R4718:Mapk7'
ID354238
Institutional Source Beutler Lab
Gene Symbol Mapk7
Ensembl Gene ENSMUSG00000001034
Gene Namemitogen-activated protein kinase 7
Synonymsbig MAP kinase 1, Erk5-T, BMK1, ERK5
MMRRC Submission 041985-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4718 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location61488812-61494406 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 61489254 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 693 (S693P)
Ref Sequence ENSEMBL: ENSMUSP00000104354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040522] [ENSMUST00000064783] [ENSMUST00000079080] [ENSMUST00000101085] [ENSMUST00000108714] [ENSMUST00000153441]
Predicted Effect probably benign
Transcript: ENSMUST00000040522
SMART Domains Protein: ENSMUSP00000038971
Gene: ENSMUSG00000042436

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
FBG 38 280 5.6e-119 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000064783
SMART Domains Protein: ENSMUSP00000070848
Gene: ENSMUSG00000042436

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
FBG 38 257 3.39e-130 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000079080
AA Change: S762P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000078087
Gene: ENSMUSG00000001034
AA Change: S762P

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
S_TKc 55 347 5.66e-96 SMART
low complexity region 433 447 N/A INTRINSIC
low complexity region 476 492 N/A INTRINSIC
coiled coil region 508 544 N/A INTRINSIC
low complexity region 578 603 N/A INTRINSIC
low complexity region 620 644 N/A INTRINSIC
low complexity region 675 692 N/A INTRINSIC
low complexity region 758 772 N/A INTRINSIC
low complexity region 791 803 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000101085
AA Change: S659P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000098646
Gene: ENSMUSG00000001034
AA Change: S659P

DomainStartEndE-ValueType
S_TKc 4 277 3.48e-73 SMART
low complexity region 363 377 N/A INTRINSIC
coiled coil region 405 441 N/A INTRINSIC
low complexity region 475 500 N/A INTRINSIC
low complexity region 517 541 N/A INTRINSIC
low complexity region 572 589 N/A INTRINSIC
low complexity region 655 669 N/A INTRINSIC
low complexity region 688 700 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108714
AA Change: S693P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000104354
Gene: ENSMUSG00000001034
AA Change: S693P

DomainStartEndE-ValueType
S_TKc 1 278 1.76e-74 SMART
low complexity region 364 378 N/A INTRINSIC
low complexity region 407 423 N/A INTRINSIC
coiled coil region 439 475 N/A INTRINSIC
low complexity region 509 534 N/A INTRINSIC
low complexity region 551 575 N/A INTRINSIC
low complexity region 606 623 N/A INTRINSIC
low complexity region 689 703 N/A INTRINSIC
low complexity region 722 734 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123360
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125840
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126308
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126495
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127073
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128478
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129272
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135521
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139663
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139932
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140779
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152755
Predicted Effect probably benign
Transcript: ENSMUST00000153441
SMART Domains Protein: ENSMUSP00000116084
Gene: ENSMUSG00000001034

DomainStartEndE-ValueType
PDB:4IC8|B 1 49 2e-26 PDB
low complexity region 51 65 N/A INTRINSIC
low complexity region 94 110 N/A INTRINSIC
coiled coil region 126 162 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the MAP kinase family. MAP kinases act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. This kinase is specifically activated by mitogen-activated protein kinase kinase 5 (MAP2K5/MEK5). It is involved in the downstream signaling processes of various receptor molecules including receptor type kinases, and G protein-coupled receptors. In response to extracelluar signals, this kinase translocates to cell nucleus, where it regulates gene expression by phosphorylating, and activating different transcription factors. Four alternatively spliced transcript variants of this gene encoding two distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to embryonic growth retardation and midgestational lethality due to multiple developmental anomalies and vascular remodelling, cardiac development, and placental defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930519G04Rik G A 5: 114,863,554 probably null Het
Acsm2 A T 7: 119,573,603 Y147F probably damaging Het
Alg12 A T 15: 88,806,053 Y413N probably damaging Het
Arntl A T 7: 113,303,361 I399F probably damaging Het
Arrdc3 A T 13: 80,883,867 Q73L possibly damaging Het
Atp13a5 T C 16: 29,248,170 K1017E probably damaging Het
Bms1 T C 6: 118,403,235 N704D possibly damaging Het
Bsph1 T A 7: 13,472,182 Y47* probably null Het
Crat A T 2: 30,408,164 Y174* probably null Het
Csmd3 G T 15: 47,698,150 Y2254* probably null Het
Cyld T A 8: 88,742,305 I568N probably damaging Het
Dapl1 T C 2: 59,484,728 V7A probably benign Het
Dhx29 G A 13: 112,946,935 R508H unknown Het
Dnah9 A G 11: 66,085,473 I1250T probably benign Het
Dnajb3 C T 1: 88,205,339 D114N probably benign Het
Dsg1b A G 18: 20,397,929 N446D probably damaging Het
Dthd1 T A 5: 62,818,793 V270E probably damaging Het
F2rl3 A C 8: 72,762,908 R254S possibly damaging Het
Fam208b A T 13: 3,574,495 D1818E probably benign Het
Fgfr2 A G 7: 130,261,788 S24P probably damaging Het
Fpr2 T C 17: 17,893,336 V198A probably benign Het
Gbp2b G A 3: 142,598,995 G64D probably damaging Het
Gbp9 T G 5: 105,083,758 N321H probably damaging Het
Gk2 T A 5: 97,455,866 Y371F probably benign Het
Gm10382 T C 5: 125,389,398 probably benign Het
Gpatch3 A G 4: 133,582,544 D396G probably benign Het
Heatr5a A C 12: 51,916,163 L985V possibly damaging Het
Homer1 T A 13: 93,391,764 V269E probably damaging Het
Hspbap1 T C 16: 35,787,322 V66A probably benign Het
Ighv7-2 A C 12: 113,912,469 I5M possibly damaging Het
Ints7 T A 1: 191,583,277 F108Y possibly damaging Het
Itga7 CT CTGGGGATT 10: 128,940,734 probably null Het
Junb G A 8: 84,978,432 probably benign Het
Lcp2 A G 11: 34,070,992 N116S probably benign Het
Lrguk A G 6: 34,029,496 T14A probably benign Het
Lrrcc1 T A 3: 14,536,032 H41Q probably damaging Het
Ltb C A 17: 35,195,337 probably null Het
Mbd5 A T 2: 49,256,402 H208L possibly damaging Het
Megf9 A T 4: 70,448,778 S322R possibly damaging Het
Mgat4c T C 10: 102,388,606 V227A probably damaging Het
Mospd3 G A 5: 137,599,653 T151M probably benign Het
Mpl A G 4: 118,456,724 S115P probably benign Het
Myo6 C A 9: 80,246,517 D258E probably benign Het
N4bp2 G A 5: 65,803,463 M492I probably damaging Het
Ndst3 G A 3: 123,672,266 A19V probably benign Het
Nkx2-3 C A 19: 43,612,643 T48K probably benign Het
Nlrp4f T C 13: 65,194,989 T281A probably benign Het
Nmur1 A G 1: 86,387,741 V157A probably damaging Het
Obscn A T 11: 59,021,954 F6992L probably damaging Het
Ocm G T 5: 144,024,557 P22Q possibly damaging Het
Olfr1105 T C 2: 87,033,895 T109A probably damaging Het
Osbp2 C A 11: 3,711,793 C753F probably damaging Het
Pabpc2 A G 18: 39,774,503 T274A probably benign Het
Pamr1 T A 2: 102,642,336 I660N probably damaging Het
Papola C T 12: 105,820,448 T466I possibly damaging Het
Pask T C 1: 93,322,196 E494G possibly damaging Het
Pck1 A T 2: 173,155,221 I219F probably damaging Het
Pgm3 T C 9: 86,570,395 E4G probably benign Het
Pgs1 A G 11: 118,005,883 H462R probably damaging Het
Phlpp2 T A 8: 109,940,820 M1327K probably benign Het
Pkhd1 C A 1: 20,081,228 G3815W probably damaging Het
Plin4 T A 17: 56,106,981 I215F possibly damaging Het
Plod1 T G 4: 147,916,244 probably benign Het
Ppfia2 T C 10: 106,858,285 S707P probably damaging Het
Psmd12 A G 11: 107,486,433 Q86R probably benign Het
Rasgrf2 C A 13: 91,990,830 probably null Het
Rictor T C 15: 6,783,160 S926P possibly damaging Het
Rras2 A T 7: 114,050,349 I160N probably benign Het
Slc27a6 A T 18: 58,605,066 Y398F probably benign Het
Speer4f1 A G 5: 17,480,424 E239G unknown Het
Sppl2c T C 11: 104,188,315 I647T probably benign Het
Sptan1 A G 2: 30,031,062 Y2467C probably damaging Het
Sptbn1 G T 11: 30,154,297 H136N probably damaging Het
Stau2 T C 1: 16,346,045 probably null Het
Tet1 T A 10: 62,813,812 I40F probably damaging Het
Tnfaip2 A G 12: 111,446,029 E288G possibly damaging Het
Trav7-5 T A 14: 53,531,153 H59Q probably benign Het
Usp53 T C 3: 122,933,982 I984V probably benign Het
Wdfy4 A G 14: 33,145,316 I403T probably benign Het
Yars2 T A 16: 16,309,340 M423K probably benign Het
Zfp292 A T 4: 34,819,521 V272D possibly damaging Het
Zmynd11 A T 13: 9,689,567 V478D possibly damaging Het
Other mutations in Mapk7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01510:Mapk7 APN 11 61491160 missense probably damaging 1.00
IGL02289:Mapk7 APN 11 61489959 unclassified probably null
IGL03108:Mapk7 APN 11 61491672 missense probably damaging 1.00
IGL03342:Mapk7 APN 11 61491390 missense probably damaging 1.00
FR4340:Mapk7 UTSW 11 61490206 intron probably benign
FR4589:Mapk7 UTSW 11 61490222 intron probably benign
R1497:Mapk7 UTSW 11 61493863 missense possibly damaging 0.53
R1866:Mapk7 UTSW 11 61489413 missense probably benign 0.27
R2870:Mapk7 UTSW 11 61490212 intron probably benign
R2871:Mapk7 UTSW 11 61490212 intron probably benign
R2872:Mapk7 UTSW 11 61490212 intron probably benign
R3831:Mapk7 UTSW 11 61489854 missense possibly damaging 0.83
R3832:Mapk7 UTSW 11 61489854 missense possibly damaging 0.83
R3833:Mapk7 UTSW 11 61489854 missense possibly damaging 0.83
R4378:Mapk7 UTSW 11 61493667 missense probably damaging 1.00
R4428:Mapk7 UTSW 11 61489229 missense possibly damaging 0.90
R4642:Mapk7 UTSW 11 61490901 missense probably damaging 0.99
R4692:Mapk7 UTSW 11 61489242 missense possibly damaging 0.73
R4755:Mapk7 UTSW 11 61490843 missense probably damaging 1.00
R4916:Mapk7 UTSW 11 61493649 missense probably damaging 0.97
R4933:Mapk7 UTSW 11 61493908 unclassified probably benign
R5825:Mapk7 UTSW 11 61490381 missense possibly damaging 0.66
R5875:Mapk7 UTSW 11 61493698 missense probably benign 0.13
R5910:Mapk7 UTSW 11 61493621 start codon destroyed probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCTTGATGCTGGGTCTATCC -3'
(R):5'- GTTCTCTGGCACTCCAAAGG -3'

Sequencing Primer
(F):5'- TGGGTCTATCCTGGCAGCAAG -3'
(R):5'- CACTCCAAAGGGCAGTGG -3'
Posted On2015-10-21