Incidental Mutation 'R4718:Wdfy4'
ID354252
Institutional Source Beutler Lab
Gene Symbol Wdfy4
Ensembl Gene ENSMUSG00000051506
Gene NameWD repeat and FYVE domain containing 4
Synonyms
MMRRC Submission 041985-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4718 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location32959547-33185508 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33145316 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 403 (I403T)
Ref Sequence ENSEMBL: ENSMUSP00000057556 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061753] [ENSMUST00000130509]
Predicted Effect probably benign
Transcript: ENSMUST00000061753
AA Change: I403T

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000057556
Gene: ENSMUSG00000051506
AA Change: I403T

DomainStartEndE-ValueType
low complexity region 69 77 N/A INTRINSIC
low complexity region 204 222 N/A INTRINSIC
low complexity region 508 522 N/A INTRINSIC
low complexity region 618 632 N/A INTRINSIC
low complexity region 644 661 N/A INTRINSIC
low complexity region 1585 1604 N/A INTRINSIC
low complexity region 1899 1909 N/A INTRINSIC
Pfam:PH_BEACH 2237 2348 1.2e-9 PFAM
Beach 2378 2660 3.69e-196 SMART
WD40 2761 2801 1.98e1 SMART
WD40 2811 2850 5.18e-7 SMART
WD40 2853 2891 9.94e-1 SMART
WD40 2893 2940 3.17e-2 SMART
WD40 2986 3021 3.31e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130509
AA Change: I403T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000117068
Gene: ENSMUSG00000051506
AA Change: I403T

DomainStartEndE-ValueType
low complexity region 69 77 N/A INTRINSIC
low complexity region 204 222 N/A INTRINSIC
low complexity region 508 522 N/A INTRINSIC
low complexity region 618 632 N/A INTRINSIC
low complexity region 644 661 N/A INTRINSIC
low complexity region 1596 1615 N/A INTRINSIC
low complexity region 1795 1819 N/A INTRINSIC
low complexity region 2019 2029 N/A INTRINSIC
Pfam:PH_BEACH 2362 2473 1.2e-9 PFAM
Beach 2503 2785 3.69e-196 SMART
WD40 2886 2926 1.98e1 SMART
WD40 2936 2975 5.18e-7 SMART
WD40 2978 3016 9.94e-1 SMART
WD40 3018 3065 3.17e-2 SMART
WD40 3111 3146 3.31e0 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930519G04Rik G A 5: 114,863,554 probably null Het
Acsm2 A T 7: 119,573,603 Y147F probably damaging Het
Alg12 A T 15: 88,806,053 Y413N probably damaging Het
Arntl A T 7: 113,303,361 I399F probably damaging Het
Arrdc3 A T 13: 80,883,867 Q73L possibly damaging Het
Atp13a5 T C 16: 29,248,170 K1017E probably damaging Het
Bms1 T C 6: 118,403,235 N704D possibly damaging Het
Bsph1 T A 7: 13,472,182 Y47* probably null Het
Crat A T 2: 30,408,164 Y174* probably null Het
Csmd3 G T 15: 47,698,150 Y2254* probably null Het
Cyld T A 8: 88,742,305 I568N probably damaging Het
Dapl1 T C 2: 59,484,728 V7A probably benign Het
Dhx29 G A 13: 112,946,935 R508H unknown Het
Dnah9 A G 11: 66,085,473 I1250T probably benign Het
Dnajb3 C T 1: 88,205,339 D114N probably benign Het
Dsg1b A G 18: 20,397,929 N446D probably damaging Het
Dthd1 T A 5: 62,818,793 V270E probably damaging Het
F2rl3 A C 8: 72,762,908 R254S possibly damaging Het
Fam208b A T 13: 3,574,495 D1818E probably benign Het
Fgfr2 A G 7: 130,261,788 S24P probably damaging Het
Fpr2 T C 17: 17,893,336 V198A probably benign Het
Gbp2b G A 3: 142,598,995 G64D probably damaging Het
Gbp9 T G 5: 105,083,758 N321H probably damaging Het
Gk2 T A 5: 97,455,866 Y371F probably benign Het
Gm10382 T C 5: 125,389,398 probably benign Het
Gpatch3 A G 4: 133,582,544 D396G probably benign Het
Heatr5a A C 12: 51,916,163 L985V possibly damaging Het
Homer1 T A 13: 93,391,764 V269E probably damaging Het
Hspbap1 T C 16: 35,787,322 V66A probably benign Het
Ighv7-2 A C 12: 113,912,469 I5M possibly damaging Het
Ints7 T A 1: 191,583,277 F108Y possibly damaging Het
Itga7 CT CTGGGGATT 10: 128,940,734 probably null Het
Junb G A 8: 84,978,432 probably benign Het
Lcp2 A G 11: 34,070,992 N116S probably benign Het
Lrguk A G 6: 34,029,496 T14A probably benign Het
Lrrcc1 T A 3: 14,536,032 H41Q probably damaging Het
Ltb C A 17: 35,195,337 probably null Het
Mapk7 A G 11: 61,489,254 S693P possibly damaging Het
Mbd5 A T 2: 49,256,402 H208L possibly damaging Het
Megf9 A T 4: 70,448,778 S322R possibly damaging Het
Mgat4c T C 10: 102,388,606 V227A probably damaging Het
Mospd3 G A 5: 137,599,653 T151M probably benign Het
Mpl A G 4: 118,456,724 S115P probably benign Het
Myo6 C A 9: 80,246,517 D258E probably benign Het
N4bp2 G A 5: 65,803,463 M492I probably damaging Het
Ndst3 G A 3: 123,672,266 A19V probably benign Het
Nkx2-3 C A 19: 43,612,643 T48K probably benign Het
Nlrp4f T C 13: 65,194,989 T281A probably benign Het
Nmur1 A G 1: 86,387,741 V157A probably damaging Het
Obscn A T 11: 59,021,954 F6992L probably damaging Het
Ocm G T 5: 144,024,557 P22Q possibly damaging Het
Olfr1105 T C 2: 87,033,895 T109A probably damaging Het
Osbp2 C A 11: 3,711,793 C753F probably damaging Het
Pabpc2 A G 18: 39,774,503 T274A probably benign Het
Pamr1 T A 2: 102,642,336 I660N probably damaging Het
Papola C T 12: 105,820,448 T466I possibly damaging Het
Pask T C 1: 93,322,196 E494G possibly damaging Het
Pck1 A T 2: 173,155,221 I219F probably damaging Het
Pgm3 T C 9: 86,570,395 E4G probably benign Het
Pgs1 A G 11: 118,005,883 H462R probably damaging Het
Phlpp2 T A 8: 109,940,820 M1327K probably benign Het
Pkhd1 C A 1: 20,081,228 G3815W probably damaging Het
Plin4 T A 17: 56,106,981 I215F possibly damaging Het
Plod1 T G 4: 147,916,244 probably benign Het
Ppfia2 T C 10: 106,858,285 S707P probably damaging Het
Psmd12 A G 11: 107,486,433 Q86R probably benign Het
Rasgrf2 C A 13: 91,990,830 probably null Het
Rictor T C 15: 6,783,160 S926P possibly damaging Het
Rras2 A T 7: 114,050,349 I160N probably benign Het
Slc27a6 A T 18: 58,605,066 Y398F probably benign Het
Speer4f1 A G 5: 17,480,424 E239G unknown Het
Sppl2c T C 11: 104,188,315 I647T probably benign Het
Sptan1 A G 2: 30,031,062 Y2467C probably damaging Het
Sptbn1 G T 11: 30,154,297 H136N probably damaging Het
Stau2 T C 1: 16,346,045 probably null Het
Tet1 T A 10: 62,813,812 I40F probably damaging Het
Tnfaip2 A G 12: 111,446,029 E288G possibly damaging Het
Trav7-5 T A 14: 53,531,153 H59Q probably benign Het
Usp53 T C 3: 122,933,982 I984V probably benign Het
Yars2 T A 16: 16,309,340 M423K probably benign Het
Zfp292 A T 4: 34,819,521 V272D possibly damaging Het
Zmynd11 A T 13: 9,689,567 V478D possibly damaging Het
Other mutations in Wdfy4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Wdfy4 APN 14 33102539 missense possibly damaging 0.93
IGL01116:Wdfy4 APN 14 32959977 missense probably damaging 1.00
IGL01449:Wdfy4 APN 14 33104037 missense probably damaging 0.99
IGL01567:Wdfy4 APN 14 33151661 missense probably benign 0.01
IGL01700:Wdfy4 APN 14 33020238 splice site probably benign
IGL01931:Wdfy4 APN 14 33155753 missense probably damaging 1.00
IGL01981:Wdfy4 APN 14 33133716 missense probably damaging 1.00
IGL01988:Wdfy4 APN 14 33076480 missense possibly damaging 0.75
IGL02026:Wdfy4 APN 14 33093300 missense probably damaging 1.00
IGL02066:Wdfy4 APN 14 33149566 missense probably benign
IGL02468:Wdfy4 APN 14 32966432 missense probably benign 0.01
IGL02512:Wdfy4 APN 14 33042491 missense probably benign 0.01
IGL02597:Wdfy4 APN 14 33090861 nonsense probably null
IGL02752:Wdfy4 APN 14 33076326 missense probably damaging 1.00
IGL02792:Wdfy4 APN 14 33095305 missense probably benign 0.01
IGL02826:Wdfy4 APN 14 32971750 missense possibly damaging 0.47
IGL02903:Wdfy4 APN 14 33109650 missense probably damaging 1.00
IGL02955:Wdfy4 APN 14 33076284 missense probably damaging 1.00
IGL03031:Wdfy4 APN 14 33140651 missense probably damaging 1.00
IGL03102:Wdfy4 APN 14 32966435 missense probably damaging 1.00
IGL03123:Wdfy4 APN 14 33162870 missense probably benign 0.01
IGL03198:Wdfy4 APN 14 33125887 missense probably damaging 1.00
IGL03250:Wdfy4 APN 14 32977167 missense probably damaging 0.99
IGL03277:Wdfy4 APN 14 33068904 missense probably benign 0.01
IGL03398:Wdfy4 APN 14 33047290 missense probably benign 0.14
Dollar UTSW 14 33020311 missense probably damaging 1.00
kings_canyon UTSW 14 33109519 nonsense probably null
sequoia UTSW 14 33100903 critical splice donor site probably null
watchtower UTSW 14 33083639 critical splice donor site probably null
R0014:Wdfy4 UTSW 14 33107173 missense possibly damaging 0.72
R0067:Wdfy4 UTSW 14 33162751 missense probably null 1.00
R0085:Wdfy4 UTSW 14 33078243 missense possibly damaging 0.81
R0277:Wdfy4 UTSW 14 33083785 missense possibly damaging 0.83
R0436:Wdfy4 UTSW 14 33083812 splice site probably benign
R0496:Wdfy4 UTSW 14 33140738 splice site probably benign
R0514:Wdfy4 UTSW 14 33080775 missense probably benign 0.22
R0548:Wdfy4 UTSW 14 33042621 missense probably benign
R0590:Wdfy4 UTSW 14 33041174 missense probably benign 0.09
R0647:Wdfy4 UTSW 14 33109699 missense possibly damaging 0.96
R0766:Wdfy4 UTSW 14 33140612 missense probably damaging 1.00
R0981:Wdfy4 UTSW 14 33147092 missense probably benign 0.03
R1024:Wdfy4 UTSW 14 33079966 missense possibly damaging 0.81
R1113:Wdfy4 UTSW 14 32971738 missense possibly damaging 0.47
R1252:Wdfy4 UTSW 14 32971772 splice site probably null
R1415:Wdfy4 UTSW 14 33041180 missense possibly damaging 0.60
R1475:Wdfy4 UTSW 14 33108688 missense probably benign 0.14
R1483:Wdfy4 UTSW 14 33100966 missense probably benign 0.41
R1490:Wdfy4 UTSW 14 33152538 critical splice donor site probably null
R1512:Wdfy4 UTSW 14 32960808 missense probably damaging 0.98
R1615:Wdfy4 UTSW 14 33042512 missense probably damaging 1.00
R1628:Wdfy4 UTSW 14 32959961 missense probably damaging 1.00
R1643:Wdfy4 UTSW 14 33073585 critical splice acceptor site probably null
R1729:Wdfy4 UTSW 14 33096005 missense possibly damaging 0.85
R1859:Wdfy4 UTSW 14 33103983 missense probably damaging 0.99
R1933:Wdfy4 UTSW 14 33133344 missense probably benign 0.08
R1957:Wdfy4 UTSW 14 32971684 missense probably damaging 1.00
R1968:Wdfy4 UTSW 14 33106044 missense possibly damaging 0.95
R2032:Wdfy4 UTSW 14 33146989 missense probably benign 0.11
R2241:Wdfy4 UTSW 14 33073511 missense possibly damaging 0.81
R2391:Wdfy4 UTSW 14 33162807 missense possibly damaging 0.92
R2888:Wdfy4 UTSW 14 33109519 nonsense probably null
R2889:Wdfy4 UTSW 14 33109519 nonsense probably null
R3114:Wdfy4 UTSW 14 33089903 missense probably damaging 0.97
R3757:Wdfy4 UTSW 14 33023374 missense probably benign 0.17
R3758:Wdfy4 UTSW 14 33023374 missense probably benign 0.17
R3797:Wdfy4 UTSW 14 33140645 missense probably damaging 1.00
R3890:Wdfy4 UTSW 14 33047280 missense probably damaging 1.00
R3892:Wdfy4 UTSW 14 33047280 missense probably damaging 1.00
R3945:Wdfy4 UTSW 14 32966395 missense probably damaging 0.99
R4011:Wdfy4 UTSW 14 33102680 splice site probably benign
R4091:Wdfy4 UTSW 14 33125880 missense possibly damaging 0.93
R4449:Wdfy4 UTSW 14 33096083 missense probably damaging 1.00
R4585:Wdfy4 UTSW 14 33087955 missense possibly damaging 0.89
R4628:Wdfy4 UTSW 14 33102558 missense probably damaging 0.97
R4629:Wdfy4 UTSW 14 33102558 missense probably damaging 0.97
R4655:Wdfy4 UTSW 14 32989936 missense probably damaging 0.98
R4689:Wdfy4 UTSW 14 33109548 missense possibly damaging 0.88
R4862:Wdfy4 UTSW 14 33100903 critical splice donor site probably null
R4884:Wdfy4 UTSW 14 32988895 nonsense probably null
R4894:Wdfy4 UTSW 14 33155760 missense probably benign 0.03
R4929:Wdfy4 UTSW 14 33047256 missense possibly damaging 0.90
R4932:Wdfy4 UTSW 14 33029013 missense probably damaging 1.00
R5014:Wdfy4 UTSW 14 33100940 missense probably benign 0.02
R5020:Wdfy4 UTSW 14 33079935 missense probably damaging 1.00
R5049:Wdfy4 UTSW 14 33152670 missense possibly damaging 0.78
R5276:Wdfy4 UTSW 14 33047275 missense probably damaging 1.00
R5318:Wdfy4 UTSW 14 33078343 missense possibly damaging 0.95
R5338:Wdfy4 UTSW 14 33090866 missense probably damaging 1.00
R5349:Wdfy4 UTSW 14 32988899 missense probably damaging 1.00
R5411:Wdfy4 UTSW 14 32960002 missense probably damaging 1.00
R5435:Wdfy4 UTSW 14 33020311 missense probably damaging 1.00
R5463:Wdfy4 UTSW 14 33151732 missense probably benign 0.17
R5591:Wdfy4 UTSW 14 33107130 missense probably benign 0.09
R5598:Wdfy4 UTSW 14 33133497 missense probably damaging 1.00
R5654:Wdfy4 UTSW 14 33107618 splice site probably null
R5890:Wdfy4 UTSW 14 33102577 missense possibly damaging 0.91
R5894:Wdfy4 UTSW 14 33133360 missense possibly damaging 0.86
R5964:Wdfy4 UTSW 14 33106011 missense probably damaging 1.00
R6036:Wdfy4 UTSW 14 33146990 missense probably damaging 0.97
R6036:Wdfy4 UTSW 14 33146990 missense probably damaging 0.97
R6074:Wdfy4 UTSW 14 33083639 critical splice donor site probably null
R6135:Wdfy4 UTSW 14 32971711 missense probably damaging 0.99
R6276:Wdfy4 UTSW 14 33109525 missense possibly damaging 0.54
R6357:Wdfy4 UTSW 14 33101049 nonsense probably null
R6370:Wdfy4 UTSW 14 33068850 missense probably benign 0.16
R6390:Wdfy4 UTSW 14 33104094 missense probably damaging 0.99
R6413:Wdfy4 UTSW 14 32967647 missense probably damaging 1.00
R6450:Wdfy4 UTSW 14 33108692 missense probably damaging 1.00
R6522:Wdfy4 UTSW 14 33146944 missense probably damaging 0.98
R6657:Wdfy4 UTSW 14 33047251 missense possibly damaging 0.70
R6761:Wdfy4 UTSW 14 33095951 missense possibly damaging 0.89
R6763:Wdfy4 UTSW 14 33042512 missense probably damaging 1.00
R6952:Wdfy4 UTSW 14 32959966 missense probably damaging 1.00
R6985:Wdfy4 UTSW 14 33099117 missense possibly damaging 0.68
X0028:Wdfy4 UTSW 14 33080636 missense probably benign
X0053:Wdfy4 UTSW 14 33162942 start codon destroyed probably null 0.99
X0062:Wdfy4 UTSW 14 33107618 splice site probably null
Predicted Primers PCR Primer
(F):5'- TCCGAGCTCTCCTTGATCAG -3'
(R):5'- ATTACATGCTGAGTCCTTGTGAGAG -3'

Sequencing Primer
(F):5'- TGATCAGACGCTGCACCTTAG -3'
(R):5'- GCTCAAGGATGCATTTCTAGACAG -3'
Posted On2015-10-21