Incidental Mutation 'R4721:Gkn3'
ID354458
Institutional Source Beutler Lab
Gene Symbol Gkn3
Ensembl Gene ENSMUSG00000030048
Gene Namegastrokine 3
Synonyms
MMRRC Submission 041986-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R4721 (G1)
Quality Score198
Status Validated
Chromosome6
Chromosomal Location87383256-87388935 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 87383525 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 163 (A163T)
Ref Sequence ENSEMBL: ENSMUSP00000032127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032127] [ENSMUST00000032128]
Predicted Effect probably damaging
Transcript: ENSMUST00000032127
AA Change: A163T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032127
Gene: ENSMUSG00000030048
AA Change: A163T

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
BRICHOS 63 155 1.47e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000032128
SMART Domains Protein: ENSMUSP00000032128
Gene: ENSMUSG00000030049

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
BRICHOS 54 151 6.63e-34 SMART
Meta Mutation Damage Score 0.0456 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 98% (90/92)
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T C 14: 32,663,150 D286G probably benign Het
Abca15 G A 7: 120,350,775 E491K probably benign Het
Acsl5 A G 19: 55,280,530 T208A probably benign Het
Adamts10 T A 17: 33,545,537 probably null Het
Ahcyl1 T C 3: 107,669,917 Q313R possibly damaging Het
Ccdc71 C T 9: 108,463,423 S145L possibly damaging Het
Cep250 A G 2: 155,970,199 T472A probably damaging Het
Copa T C 1: 172,104,274 probably benign Het
Crybg1 C A 10: 43,997,887 R1075L probably damaging Het
Ddr2 T A 1: 170,005,240 K84* probably null Het
Ddx59 C T 1: 136,417,106 P172S probably benign Het
Dhx34 T A 7: 16,197,382 Q1118L possibly damaging Het
Dkkl1 T A 7: 45,207,808 I112F probably damaging Het
Dnah8 T A 17: 30,725,166 C1786S probably damaging Het
Eml6 T A 11: 29,838,525 D520V possibly damaging Het
Ergic1 T A 17: 26,638,776 V192E probably damaging Het
Fat3 T C 9: 16,029,966 E1343G probably damaging Het
Fxr1 T C 3: 34,064,232 S535P possibly damaging Het
Gm15446 C T 5: 109,943,000 H373Y probably damaging Het
Gpr157 A T 4: 150,098,963 N197Y probably benign Het
Grid2 G A 6: 64,666,201 M982I probably benign Het
Hey2 G T 10: 30,834,308 R150S possibly damaging Het
Hmcn1 T C 1: 150,772,571 probably null Het
Ighv3-3 G A 12: 114,196,536 R85* probably null Het
Ighv5-4 A T 12: 113,597,440 probably benign Het
Igsf21 A G 4: 140,107,310 S84P probably benign Het
Kif20b A G 19: 34,938,373 T517A probably benign Het
Krt83 T C 15: 101,487,982 E244G probably damaging Het
Lrp1 T C 10: 127,555,059 T2990A possibly damaging Het
Lrp1b T A 2: 40,715,369 probably null Het
Lrrc42 A T 4: 107,233,853 S382T probably benign Het
Magi2 C T 5: 20,534,469 R737W probably damaging Het
Mcc A G 18: 44,519,556 L267P probably damaging Het
Mzf1 T A 7: 13,043,296 Q727L possibly damaging Het
Mzf1 C T 7: 13,043,521 R652Q possibly damaging Het
Nkain3 C T 4: 20,485,015 A21T probably damaging Het
Nlrp4e T A 7: 23,321,096 V336E possibly damaging Het
Nptn C T 9: 58,640,776 R155C probably damaging Het
Nr2c2 T C 6: 92,139,847 I10T possibly damaging Het
Olfr1148 T A 2: 87,833,171 I44N probably damaging Het
Olfr341 T C 2: 36,479,824 Y102C probably benign Het
Olfr385 C T 11: 73,589,447 C97Y probably damaging Het
Pdzk1 G T 3: 96,869,202 E493* probably null Het
Plekhh1 GTCAAA G 12: 79,075,420 probably null Het
Polr3b T C 10: 84,656,003 V342A possibly damaging Het
Prg3 T C 2: 84,991,406 V125A possibly damaging Het
Raph1 G A 1: 60,503,001 probably benign Het
Rassf2 A G 2: 132,004,438 V133A probably benign Het
Rbm22 G A 18: 60,564,391 R56H probably damaging Het
Rbpjl A C 2: 164,404,527 S31R probably benign Het
Reln A G 5: 21,919,222 V2762A probably damaging Het
Rxrg T A 1: 167,625,052 I141N probably damaging Het
Scn7a C A 2: 66,684,185 G1082C probably damaging Het
Selenon C A 4: 134,543,076 E322* probably null Het
Sipa1 C T 19: 5,660,385 R199Q probably damaging Het
Slc26a7 A T 4: 14,510,261 probably null Het
Slc37a4 T C 9: 44,401,490 S314P possibly damaging Het
Smarce1 T C 11: 99,220,717 I59V probably benign Het
Stk19 T C 17: 34,823,144 probably null Het
Susd2 C T 10: 75,638,130 D544N probably benign Het
Tcf7l2 G T 19: 55,931,454 R465L possibly damaging Het
Tfap2d T A 1: 19,104,760 S146T possibly damaging Het
Tmem156 A G 5: 65,091,527 F10S probably benign Het
Tmem63c G T 12: 87,057,180 A68S possibly damaging Het
Tnfrsf21 T C 17: 43,085,504 C560R probably damaging Het
Trav10n C T 14: 53,122,133 T7I probably benign Het
Ttc38 C T 15: 85,838,746 R132W probably benign Het
Tvp23a T C 16: 10,427,411 K108R probably benign Het
Vmn1r233 T C 17: 20,994,617 M24V probably benign Het
Vmn1r88 T A 7: 13,178,524 L269* probably null Het
Vmn2r101 T A 17: 19,612,025 M761K probably damaging Het
Vps13b C T 15: 35,910,718 Q3543* probably null Het
Wdr37 T C 13: 8,854,029 E101G possibly damaging Het
Zc3hc1 A G 6: 30,374,900 V214A probably benign Het
Zcchc9 A T 13: 91,800,609 probably null Het
Zdbf2 A T 1: 63,308,792 Q2110L possibly damaging Het
Zfp516 T G 18: 82,957,111 L478R possibly damaging Het
Other mutations in Gkn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02170:Gkn3 APN 6 87383511 missense possibly damaging 0.70
IGL02746:Gkn3 APN 6 87387357 splice site probably benign
IGL03345:Gkn3 APN 6 87388816 missense probably null 0.09
R1758:Gkn3 UTSW 6 87388835 start codon destroyed probably benign
R2303:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R2304:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R2363:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R2365:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R2897:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R2898:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R2983:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R3031:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R3426:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R3433:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R4085:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R4086:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R4087:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R4088:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R4089:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R4090:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R4163:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R4164:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R4720:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R4722:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R4723:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R4766:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R4941:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R5004:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R5163:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R6078:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R6079:Gkn3 UTSW 6 87383525 missense probably damaging 1.00
R6502:Gkn3 UTSW 6 87388804 missense probably benign 0.01
R6924:Gkn3 UTSW 6 87388802 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CCATGGGAAGCCAACATGTG -3'
(R):5'- TTCTTCAAGACACAAGGGTCC -3'

Sequencing Primer
(F):5'- TGTGGAGCACAGAGGACTGC -3'
(R):5'- CACACTGGGCTAAGGGGTTAC -3'
Posted On2015-10-21