Incidental Mutation 'R4721:Tcf7l2'
ID354508
Institutional Source Beutler Lab
Gene Symbol Tcf7l2
Ensembl Gene ENSMUSG00000024985
Gene Nametranscription factor 7 like 2, T cell specific, HMG box
SynonymsTCF4B, mTcf-4B, mTcf-4E, TCF4E, Tcf4, Tcf-4
MMRRC Submission 041986-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4721 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location55741810-55933654 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 55931454 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 465 (R465L)
Ref Sequence ENSEMBL: ENSMUSP00000107284 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041717] [ENSMUST00000061496] [ENSMUST00000111646] [ENSMUST00000111656] [ENSMUST00000111657] [ENSMUST00000111658] [ENSMUST00000111659] [ENSMUST00000111662] [ENSMUST00000153888]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041717
AA Change: A424S

PolyPhen 2 Score 0.682 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000042950
Gene: ENSMUSG00000024985
AA Change: A424S

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 236 1.5e-95 PFAM
HMG 326 396 1.16e-22 SMART
low complexity region 402 410 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000061496
AA Change: A441S

PolyPhen 2 Score 0.757 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000050081
Gene: ENSMUSG00000024985
AA Change: A441S

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 236 1.7e-95 PFAM
HMG 326 396 1.16e-22 SMART
low complexity region 402 410 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111646
SMART Domains Protein: ENSMUSP00000107273
Gene: ENSMUSG00000024985

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 76 2.4e-37 PFAM
HMG 166 236 1.16e-22 SMART
low complexity region 242 250 N/A INTRINSIC
c-clamp 278 298 2.25e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111656
SMART Domains Protein: ENSMUSP00000107283
Gene: ENSMUSG00000024985

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 236 1.5e-95 PFAM
HMG 326 396 1.16e-22 SMART
low complexity region 402 410 N/A INTRINSIC
c-clamp 438 458 2.25e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111657
AA Change: R465L

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000107284
Gene: ENSMUSG00000024985
AA Change: R465L

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 236 2.1e-95 PFAM
HMG 326 396 1.16e-22 SMART
low complexity region 402 410 N/A INTRINSIC
c-clamp 438 468 2.08e-14 SMART
low complexity region 471 498 N/A INTRINSIC
low complexity region 519 539 N/A INTRINSIC
low complexity region 564 578 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000111658
SMART Domains Protein: ENSMUSP00000107286
Gene: ENSMUSG00000024985

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 259 4.5e-93 PFAM
HMG 350 420 1.16e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111659
AA Change: A429S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000107287
Gene: ENSMUSG00000024985
AA Change: A429S

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 236 1.7e-96 PFAM
HMG 331 401 1.16e-22 SMART
low complexity region 407 415 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111662
AA Change: R473L

PolyPhen 2 Score 0.718 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000107291
Gene: ENSMUSG00000024985
AA Change: R473L

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 236 1.7e-103 PFAM
HMG 326 396 1.16e-22 SMART
low complexity region 402 410 N/A INTRINSIC
c-clamp 421 442 1.23e-2 SMART
c-clamp 446 476 1.35e-13 SMART
low complexity region 479 506 N/A INTRINSIC
low complexity region 527 547 N/A INTRINSIC
low complexity region 572 586 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127233
SMART Domains Protein: ENSMUSP00000123428
Gene: ENSMUSG00000024985

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 229 9.3e-98 PFAM
HMG 319 389 1.16e-22 SMART
low complexity region 395 403 N/A INTRINSIC
c-clamp 414 434 2.25e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153888
SMART Domains Protein: ENSMUSP00000118661
Gene: ENSMUSG00000024985

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 217 1.2e-64 PFAM
HMG 307 377 1.16e-22 SMART
low complexity region 383 391 N/A INTRINSIC
c-clamp 402 432 5.29e-7 SMART
Meta Mutation Damage Score 0.26 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 98% (90/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a high mobility group (HMG) box-containing transcription factor that plays a key role in the Wnt signaling pathway. The protein has been implicated in blood glucose homeostasis. Genetic variants of this gene are associated with increased risk of type 2 diabetes. Several transcript variants encoding multiple different isoforms have been found for this gene.[provided by RefSeq, Oct 2010]
PHENOTYPE: Animals homozygous for a targeted mutation exhibit intestinal epithelia abnormalities and die shortly after birth. Mice heterozygous for some mutations display abnormalities in glucose homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T C 14: 32,663,150 D286G probably benign Het
Abca15 G A 7: 120,350,775 E491K probably benign Het
Acsl5 A G 19: 55,280,530 T208A probably benign Het
Adamts10 T A 17: 33,545,537 probably null Het
Ahcyl1 T C 3: 107,669,917 Q313R possibly damaging Het
Ccdc71 C T 9: 108,463,423 S145L possibly damaging Het
Cep250 A G 2: 155,970,199 T472A probably damaging Het
Copa T C 1: 172,104,274 probably benign Het
Crybg1 C A 10: 43,997,887 R1075L probably damaging Het
Ddr2 T A 1: 170,005,240 K84* probably null Het
Ddx59 C T 1: 136,417,106 P172S probably benign Het
Dhx34 T A 7: 16,197,382 Q1118L possibly damaging Het
Dkkl1 T A 7: 45,207,808 I112F probably damaging Het
Dnah8 T A 17: 30,725,166 C1786S probably damaging Het
Eml6 T A 11: 29,838,525 D520V possibly damaging Het
Ergic1 T A 17: 26,638,776 V192E probably damaging Het
Fat3 T C 9: 16,029,966 E1343G probably damaging Het
Fxr1 T C 3: 34,064,232 S535P possibly damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm15446 C T 5: 109,943,000 H373Y probably damaging Het
Gpr157 A T 4: 150,098,963 N197Y probably benign Het
Grid2 G A 6: 64,666,201 M982I probably benign Het
Hey2 G T 10: 30,834,308 R150S possibly damaging Het
Hmcn1 T C 1: 150,772,571 probably null Het
Ighv3-3 G A 12: 114,196,536 R85* probably null Het
Ighv5-4 A T 12: 113,597,440 probably benign Het
Igsf21 A G 4: 140,107,310 S84P probably benign Het
Kif20b A G 19: 34,938,373 T517A probably benign Het
Krt83 T C 15: 101,487,982 E244G probably damaging Het
Lrp1 T C 10: 127,555,059 T2990A possibly damaging Het
Lrp1b T A 2: 40,715,369 probably null Het
Lrrc42 A T 4: 107,233,853 S382T probably benign Het
Magi2 C T 5: 20,534,469 R737W probably damaging Het
Mcc A G 18: 44,519,556 L267P probably damaging Het
Mzf1 T A 7: 13,043,296 Q727L possibly damaging Het
Mzf1 C T 7: 13,043,521 R652Q possibly damaging Het
Nkain3 C T 4: 20,485,015 A21T probably damaging Het
Nlrp4e T A 7: 23,321,096 V336E possibly damaging Het
Nptn C T 9: 58,640,776 R155C probably damaging Het
Nr2c2 T C 6: 92,139,847 I10T possibly damaging Het
Olfr1148 T A 2: 87,833,171 I44N probably damaging Het
Olfr341 T C 2: 36,479,824 Y102C probably benign Het
Olfr385 C T 11: 73,589,447 C97Y probably damaging Het
Pdzk1 G T 3: 96,869,202 E493* probably null Het
Plekhh1 GTCAAA G 12: 79,075,420 probably null Het
Polr3b T C 10: 84,656,003 V342A possibly damaging Het
Prg3 T C 2: 84,991,406 V125A possibly damaging Het
Raph1 G A 1: 60,503,001 probably benign Het
Rassf2 A G 2: 132,004,438 V133A probably benign Het
Rbm22 G A 18: 60,564,391 R56H probably damaging Het
Rbpjl A C 2: 164,404,527 S31R probably benign Het
Reln A G 5: 21,919,222 V2762A probably damaging Het
Rxrg T A 1: 167,625,052 I141N probably damaging Het
Scn7a C A 2: 66,684,185 G1082C probably damaging Het
Selenon C A 4: 134,543,076 E322* probably null Het
Sipa1 C T 19: 5,660,385 R199Q probably damaging Het
Slc26a7 A T 4: 14,510,261 probably null Het
Slc37a4 T C 9: 44,401,490 S314P possibly damaging Het
Smarce1 T C 11: 99,220,717 I59V probably benign Het
Stk19 T C 17: 34,823,144 probably null Het
Susd2 C T 10: 75,638,130 D544N probably benign Het
Tfap2d T A 1: 19,104,760 S146T possibly damaging Het
Tmem156 A G 5: 65,091,527 F10S probably benign Het
Tmem63c G T 12: 87,057,180 A68S possibly damaging Het
Tnfrsf21 T C 17: 43,085,504 C560R probably damaging Het
Trav10n C T 14: 53,122,133 T7I probably benign Het
Ttc38 C T 15: 85,838,746 R132W probably benign Het
Tvp23a T C 16: 10,427,411 K108R probably benign Het
Vmn1r233 T C 17: 20,994,617 M24V probably benign Het
Vmn1r88 T A 7: 13,178,524 L269* probably null Het
Vmn2r101 T A 17: 19,612,025 M761K probably damaging Het
Vps13b C T 15: 35,910,718 Q3543* probably null Het
Wdr37 T C 13: 8,854,029 E101G possibly damaging Het
Zc3hc1 A G 6: 30,374,900 V214A probably benign Het
Zcchc9 A T 13: 91,800,609 probably null Het
Zdbf2 A T 1: 63,308,792 Q2110L possibly damaging Het
Zfp516 T G 18: 82,957,111 L478R possibly damaging Het
Other mutations in Tcf7l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00771:Tcf7l2 APN 19 55917421 missense probably damaging 1.00
IGL01013:Tcf7l2 APN 19 55919627 splice site probably benign
IGL02871:Tcf7l2 APN 19 55918997 missense probably damaging 1.00
banned UTSW 19 55931432 critical splice acceptor site probably null
PIT4468001:Tcf7l2 UTSW 19 55742388 missense probably damaging 1.00
R0927:Tcf7l2 UTSW 19 55918955 missense probably damaging 1.00
R1078:Tcf7l2 UTSW 19 55743195 missense probably benign 0.19
R4580:Tcf7l2 UTSW 19 55919036 missense probably damaging 1.00
R4814:Tcf7l2 UTSW 19 55924072 nonsense probably null
R4957:Tcf7l2 UTSW 19 55931432 critical splice acceptor site probably null
R5222:Tcf7l2 UTSW 19 55898612 missense probably benign
R5484:Tcf7l2 UTSW 19 55919508 splice site probably null
R5808:Tcf7l2 UTSW 19 55908541 missense probably damaging 1.00
R5914:Tcf7l2 UTSW 19 55898560 missense probably benign 0.00
R6077:Tcf7l2 UTSW 19 55917436 nonsense probably null
R6116:Tcf7l2 UTSW 19 55919014 missense probably damaging 1.00
R6861:Tcf7l2 UTSW 19 55742523 missense probably damaging 1.00
R6970:Tcf7l2 UTSW 19 55755048 missense probably benign 0.44
R7009:Tcf7l2 UTSW 19 55894733 critical splice donor site probably null
R7382:Tcf7l2 UTSW 19 55926740 missense unknown
Predicted Primers PCR Primer
(F):5'- CAAATCAGAGTGGACCTGGG -3'
(R):5'- TTGGTCACCAGAGACAGAGG -3'

Sequencing Primer
(F):5'- AGAGTGGACCTGGGAGCCTC -3'
(R):5'- TTCCAGCCAGCGAGTTGTG -3'
Posted On2015-10-21